• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    the invention relates to a recombinant adeno-associated virus (raav) vector comprising an aavhu68 capsid produced in a production system comprising a sequence of nucleotides of sequence: 1, or a sequence of at least 75% identical to the same , which encodes the sequence: 2. the aavhu68 capsid comprises subpopulations of highly deamidated asparagine residues in asparagine - glycine pairs in the sequence of amino acids of sequence: 2. also provided are compositions containing the raav and uses thereof . furthermore, of raav having a modified aav capsid comprising at least a sub-population of vpl or vp2 proteins having a val at the position of amino acid 157 with reference to the vpl numbering aavhu68.
    公开号:BR112019017839A2
    申请号:R112019017839
    申请日:2018-02-27
    公开日:2020-04-14
    发明作者:Giles April；M Wilson James；Turner Kevin；Wang Qiang
    申请人:Univ Pennsylvania；
    IPC主号:
    专利说明:

    Descriptive Report of the Invention Patent for “ADENO ASSOCIATED VIRUS (AAV) CLADE F AND USES OF THE SAME”.
    DECLARATION CONCERNING RESEARCH OR DEVELOPMENT SPONSORED BY THE FEDERAL GOVERNMENT [001] This application contains work supported by the Defense Advanced Research Projects Agency (DARPA) under W911NF-13-20036. The US government may have certain rights in this invention.
    BACKGROUND OF THE INVENTION [002] Adenoassociated virus (AAV), a member of the Parvovirus family, is a small icosahedral virus without envelope, with single-stranded linear DNA (ssDNA) genomes of about 4.7 kilobases (kb) long. The wild-type genome comprises inverted terminal repeats (ITRs) at both ends of the DNA strand and two open reading frames (ORFs): rep and cap. Rep is composed of four overlapping genes that encode rep proteins necessary for the AAV life cycle, and the cap contains overlapping nucleotide sequences of capsid proteins: VP1, VP2 and VP3, which self-assemble to form an icosahedral symmetry capsid.
    [003] AAV is assigned to the genus Dependovirus, because the virus was discovered as a contaminant in purified adenovirus stocks. The AAV life cycle includes a latent phase in which the AAV genomes, after infection, are specifically integrated into the host chromosomes and an infectious phase in which, after infection by the adenovirus or herpes simplex virus, the integrated genomes are subsequently rescued , replicated and packaged in infectious viruses. The properties of non-pathogenicity, wide range of host infectivity, including non-dividing cells and potential chromosomal integration of the specific site make AAV a tool
    Petition 870190107951, of 10/24/2019, p. 29/188
    2/144 attractive for gene transfer.
    [004] Recombinant adenoassociated virus (rAAV) vectors derived from the replicated defect human parvovirus have been described as suitable vehicles for gene delivery. Normally, the functional rep genes and the cap gene are removed from the vector, resulting in an incompetent vector for replication. These functions are provided during the vector production system, but are absent in the final vector.
    [005] To date, there have been several well-characterized AAVs isolated from human or non-human primates (NHP). It was found that AAVs of different serotypes exhibit different transfection efficiencies and exhibit tropism for different cells or tissues. Many different AAV Clades have been described in WO 2005/033321, including Clade F, which is identified in it as having only three members, AAV9, AAVhu31 and AAVhu32. A structural analysis of AAV9 is provided in MA DiMattia et al, J. Virol. (June 2012) vol. 86 no. 12 6947-6958. This article reports that AAV9 has 60 copies (in total) of the three variable proteins (vps) that are encoded by the cap gene and have overlapping sequences. This includes VP1 (87 kDa), VP2 (73 kDa) and VP3 (62 kDa), which are present in a predicted ratio of 1: 1: 10, respectively. The entire sequence of VP3 is within VP2 and the entire VP2 is within VP1. VP1 has a unique N-terminal domain. The refined coordinates and structure factors are available in item n Q of access. 3UX1 from the RCSB PDB database.
    [006] Several different variants of AAV9 were designed to disarm or target different fabrics. See, for example, N. Pulicheria, Engineering Liver-detargeted AAV9 Vectors for Cardiac and Musculoskeletal Gene Transfer, Molecular Therapy, Vol, 19, no. 6, p. 1070-1078 (June 2011). The development of variants of the
    Petition 870190107951, of 10/24/2019, p. 30/188
    3/144
    AAV9 to deliver genes across the blood-brain barrier. See, for example, BE Deverman et al, Nature Biotech, Vol. 34, No. 2, p 204 - 211 (published online 1 Feb 2016) and Caltech press release, A. Wetherston, www.neurology-central.com/2016 / 02/10 / successful-delivery-ofgenes-through-the-blood-brain-barrier /, accessed 05/10/2016. See also WO 2016/0492301 and US 8,734,809.
    [007] What is desirable are constructs based on AAV for delivery of heterologous molecules.
    SUMMARY OF THE INVENTION [008] New AAVhu68 capsid and rep sequences are described, which are useful in manufacturing and in vectors for delivering nucleic acid molecules to host cells. In certain embodiments, a recombinant AAV is provided that has an AAVhu68 capsid that is encoded by a nucleic acid sequence of SEQ ID NO: 1 or a nucleic acid sequence at least 70% identical to SEQ ID NO: 1, at least 75 %, at least 80%, at least 85%, at least 90%, at least 95%, at least 97% or at least 99% identical to SEQ ID NO: 1, which encodes the amino acid sequence of SEQ ID NO: 2.
    [009] In one embodiment, a recombinant adenoassociated virus (rAAV) is provided that comprises: (A) an AAV68 capsid comprising one or more of: (1) AAV hu68 capsid proteins comprising: AAVhu68 vp1 proteins produced by expression of a sequence nucleic acid encoding the predicted amino acid sequence 1 to 736 of SEQ ID NO: 2, vp1 proteins produced from SEQ ID NO: 1 or vp1 proteins produced from a nucleic acid sequence at least 70% identical to SEQ ID NO: 1 encoding the predicted amino acid sequence from 1 to 736 of SEQ ID NO: 2, AAVhu68 vp2 proteins produced by expression of a nucleic acid sequence encoding the amino acid sequence
    Petition 870190107951, of 10/24/2019, p. 31/188
    4/144 predicted of at least about amino acids 138 to 736 of SEQ ID NO: 2, vp2 proteins produced from a sequence comprising at least nucleotides 412 to 2211 of SEQ ID NO: 1, or vp2 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 412 to 2211 of SEQ ID NO: 1 encoding the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 2, AAVhu68 vp3 proteins produced by expression of a nucleic acid sequence encoding the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO: 2, vp3 proteins produced from a sequence comprising at least nucleotides 607 to 2211 of SEQ ID NO: 1, or vp3 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 607 to 2211 of SEQ ID NO: 1 encoding the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO: 2; and / or (2) AAV capsid proteins comprising a heterogeneous population of vp1 proteins optionally comprising a valine at position 157 and / or a glutamic acid at position 67, a heterogeneous population of vp2 proteins optionally comprising a valine at position 157 and a population heterogeneous of vp3 proteins, wherein at least one subpopulation of the vp1 and vp2 proteins comprises a valine at position 157 and optionally further comprising a glutamic acid at position 67 based on the numbering of the vp1 capsid of SEQ ID NO: 2; and / or (3) a heterogeneous population of vp1 proteins that are the product of a nucleic acid sequence that encodes the amino acid sequence of SEQ ID NO: 2, a heterogeneous population of vp2 proteins that are the product of an acid sequence nucleic acid encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 2 and a heterogeneous population of
    Petition 870190107951, of 10/24/2019, p. 32/188
    5/144 vp3 proteins that are the product of a nucleic acid sequence that encodes at least amino acids 203 to 736 of SEQ ID NO: 2, where: vp1, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two asparagines (N) highly deamidated in asparagine-glycine pairs in SEQ ID NO: 2 and, optionally, comprising subpopulations comprising other deamidated amino acids, where deamidation results in an amino acid change; and (B) a vector genome in the AAVhu68 capsid, the vector genome comprising a nucleic acid molecule comprising repeated inverted AAV terminal sequences and a non-AAV nucleic acid sequence that encodes a product operably linked to sequences that direct expression of the product in a host cell. For example, four residues (N57, N329, N452, N512) routinely exhibit high levels of deamidation. Additional wastes (N94, N253, N270, N304, N409, N477 and Q599) also exhibit deamidation levels of up to -20% in several batches.
    [010] In certain embodiments, deamidated asparagines are deamidated in aspartic acid, iso-aspartic acid, a pair of interconverting aspartic acid / iso-aspartic acid, or combinations thereof. In certain embodiments, the deamidated glutamine (s) is (are) deamidated in (a) -glutamic acid, γ-glutamic acid, an interconversion pair of (a) -glutamic acid / γ-glutamic or combinations thereof.
    [011] In certain embodiments, the AAVhu68 capsid comprises subpopulations having one or more of: (a) at least 65% of the asparagines (N) in asparagine-glycine pairs located at positions 57 of the vp1 proteins are deamidated, based on the number of SEQ ID NO: 2; (b) at least 75% of N in asparagine-glycine pairs at position 329 of proteins vp1, v2 and vp3 are deamidated, based on
    Petition 870190107951, of 10/24/2019, p. 33/188
    6/144 in the residue numbering of the amino acid sequence of SEQ ID NO: 2; (c) at least 50% of the N in asparagine-glycine pairs at position 452 of the vp1, v2 and vp3 proteins are deamidated, based on the amino acid sequence numbering in SEQ ID NO: 2; and / or (d) at least 75% of the N in asparagine-glycine pairs at position 512 of the proteins vp1, v2 and vp3 are deamidated, based on the number of residues in the amino acid sequence of SEQ ID NO:
    2. In certain embodiments, the hu68 capsid comprises a subpopulation of vp1 in which 75% to 100% of the N at position 57 of the vp1 proteins are deamidated, as determined by mass spectrometry. In certain embodiments, the hu68 capsid comprises a subpopulation of vp1 proteins, vp2 proteins and / or vp3 proteins in which 75% to 100% of N at position 329, based on SEQ ID NO: 2 numbering, are deamidated as determined using mass spectrometry. In certain embodiments, the hu68 capsid comprises a subpopulation of vp1 proteins, vp2 proteins and / or vp3 proteins in which 75% to 100% of the N at position 452, based on SEQ ID NO: 2 numbering, are deamidated as determined using mass spectrometry. In certain embodiments, the hu68 capsid comprises a subpopulation of vp1 proteins, vp2 proteins and / or vp3 proteins in which 75% to 100% of the N at position 512, based on SEQ ID NO: 2 numbering, are deamidated. In certain embodiments, the nucleic acid sequence encoding the proteins is SEQ ID NO: 1, or a sequence of at least 80% to at least 99% identical to SEQ ID NO: 1 which encodes the amino acid sequence of SEQ ID NO :2. In certain embodiments, the sequence is at least 80% to 97% identical to SEQ ID NO: 1. In certain embodiments, the rAAVhu68 capsid further comprises at least one subpopulation of vp1, vp2 and / or vp3 proteins having amino acid modifications from SEQ ID NO: 2 comprising at least about 50 to 100% of
    Petition 870190107951, of 10/24/2019, p. 34/188
    7/144 deamidation of at least four positions selected from one or more of N57, 329, 452, 512, or combinations thereof. In certain embodiments, the hu68 capsid comprises subpopulations of vp1, vp2 and / or vp3 proteins that further comprise from 1% to about 40% deamidation in at least one or more of the positions N94, N113, N252, N253, Q259, N270 , N303, N304, N305, N319, N328, N336, N409, N410, N477, N515, N598, Q599, N628, N651, N663, N709, or combinations thereof. In certain embodiments, the hu68 capsid comprises the subpopulations of vp1, vp2 and / or vp3 proteins which further comprise one or more modifications selected from one or more modifications in one or more of the following: acetylated lysine, serine and / or phosphorylated threonine, acid isomerized aspartic, tryptophan and / or oxidized methionine, or an amidated amino acid. In certain embodiments, rAAVhu68 comprises about 60 total capsid proteins in a ratio of about 1 vp1 to about 1 to 1.5 vp2 to 3 to 10 vp3 proteins. In certain embodiments, the AAVhu68 capsid comprises about 60 total capsid proteins in a ratio of about 1 vp1 to about 1 vp2 to 3 to 9 vp3 proteins. In certain embodiments, the vector genome comprises AAV ITR sequences from an AAV source other than AAVhu68.
    [012] In certain embodiments, a composition is provided which comprises a mixed population of recombinant adenoassociated virus hu68 (rAAVhu68), in which each of the rAAVhu68 is independently selected from an rAAVhu68, as described in this document. In certain embodiments, the regular AAVhu68 capsid comprises about 60 total capsid proteins in a ratio of about 1 vp1 to about 1 to 1.5 vp2 to 3 to 10 vp3 proteins. In certain embodiments, the regular AAVhu68 capsid comprises about 60 total capsid proteins in a ratio of about 1 vp1 to
    Petition 870190107951, of 10/24/2019, p. 35/188
    8/144 about 1 vp2 to 3 to 6 vp3 proteins. In certain embodiments, the composition is formulated for intrathecal delivery and the vector genome comprises a nucleic acid sequence that encodes a product for delivery to the central nervous system. In certain embodiments, the composition is formulated for intrathecal delivery. In certain embodiments, the vector genome comprises a nucleic acid sequence that encodes an anti-HER2 antibody. In certain embodiments, the composition is formulated for intranasal or intramuscular delivery. In certain embodiments, a composition comprises at least a stock of rAAVhu68 vectors and an optional vehicle, excipient and / or preservative. [013] In certain embodiments, the use of a rAAVhu68 or a composition as described herein is provided for the delivery of a desired genetic product to a subject in need.
    [014] In certain embodiments, a rAAV production system useful for producing a recombinant AAVhu68 is provided. The production system comprises: (a) a nucleic acid sequence of the AAVhu68 capsid that encodes the amino acid sequence of SEQ ID NO: 2; (b) a nucleic acid molecule suitable for packaging in the AAVhu68 capsid, said nucleic acid molecule comprising at least one AAV inverted terminal repeat (ITR) and a non-AAV nucleic acid sequence encoding an operably linked genetic product sequences that directly express the product in a host cell; and (c) rep functions and auxiliary functions of the AAV sufficient to allow packaging of the nucleic acid molecule into the recombinant AAVhu68 capsid. In certain embodiments, the nucleic acid sequence of (a) comprises at least SEQ ID NO: 1 or a sequence of at least 70% to at least 99% identical to SEQ ID NO: 1 which encodes the amino acid sequence of SEQ ID NO: 2. In certain embodiments, the system optionally further comprises a nucleic acid sequence of
    Petition 870190107951, of 10/24/2019, p. 36/188
    9/144 about nt 607 to about nt 2211 of SEQ ID NO: 1 encoding AAVhu68 vp3 of about aa 203 to about amino acid 736 of SEQ ID NO: 2. In certain embodiments, the system comprises 293 cells of human embryonic kidney or a baculovirus system.
    [015] In certain embodiments, a method is provided to reduce the deamidation of an AAVhu68 capsid. The method comprises the production of an AAVhu68 capsid from a nucleic acid sequence containing modified AAVhu68 vp codons, with the nucleic acid sequence comprising independently modified glycine codons in one to three of the arginine glycine pairs located in the positions 58, 330, 453 and / or 513 in SEQ ID NO: 2, so that the modified codon encodes an amino acid other than glycine. In certain embodiments, the method comprises producing an AAVhu68 capsid from a nucleic acid sequence containing AAVhu68 vp codons, with the nucleic acid sequence comprising arginine codons independently modified in one to three of the arginine pairs - glycine located at positions 57, 329, 452 and / or 512 in SEQ ID NO: 2, so that the modified codon encodes an amino acid other than arginine. In certain embodiments, each modified codon encodes a different amino acid. In certain embodiments, two or more modified codons encode the same amino acid. In certain embodiments, a mutant AAVhu68 capsid, as described in this document, contains a mutation in an arginine-glycine pair, so that the glycine is changed to an alanine or serine. A mutant AAVhu68 capsid can contain one, two or three mutants, where the reference AAVhu68 natively contains four NG pairs. In certain embodiments, a mutant AAVhu68 capsid contains only a single mutation in an NG pair. In certain embodiments, a mutant AAV capsid contains mutations in two different NG pairs. In certain embodiments, an AAVhu68 capsid
    Petition 870190107951, of 10/24/2019, p. 37/188
    10/144 mutant contains mutations in two different NG pairs that are located in a structurally separate location on the AAVhu68 capsid. In certain embodiments, the mutation is not in the exclusive VP1 region. In certain embodiments, one of the mutations is in the exclusive VP1 region. Optionally, a mutant AAVhu6 capsid does not contain changes in the NG pairs, but does contain mutations to minimize or eliminate deamidation in one or more asparagines, or a glutamine, located outside an NG pair.
    [016] In certain embodiments, a mutant rAAVhu68 is provided that comprises a modified rAAVhu68 capsid with reduced deamidation compared to an unmodified AAVhu68 capsid, which is produced using the method described herein.
    [017] Still in an additional aspect, a method is provided to increase the yield and / or the packaging efficiency of a recombinant adenoassociated vector (rAAV). The method comprising manipulating an AAV capsid gene to express a vp1 protein goes at amino acid position 157, where the numbering of amino acid residues is based on the complete vp1 of AAVhu68 [SEQ ID NO: 2]. In certain embodiments, a Clade F rAAV with a glutamic acid (Glu or E) at amino acid position 67 is provided based on the numbering of SEQ ID NO: 2.
    [018] Still in an additional modality, a manipulated rAAV produced according to this method is provided.
    [019] In an additional embodiment, an AAVhu68 particle is provided that expresses an anti-HER2 antibody useful for the treatment and / or prophylaxis of HER2 + cancers.
    [020] In yet another embodiment, a nucleic acid molecule comprising a nucleic acid sequence encoding an AAVhu68 rep protein or a functional fragment thereof under the control of exogenous regulatory control sequences whose direct expression in
    Petition 870190107951, of 10/24/2019, p. 38/188
    11/144 a host cell is provided. In one embodiment, the rep protein has the amino acid sequence of SEQ ID NO: 4, or a functional fragment thereof.
    [021] These and other aspects of the invention will be apparent from the following detailed description of the invention.
    BRIEF DESCRIPTION OF THE FIGURES [022] FIGURE 1 provides an alignment showing the amino acid sequence of the capsid protein vp1 from AAVhu68 [SEQ ID NO: 16] (marked as hu.68.vp1 in alignment), with AAV9 [SEQ ID NO : 6], AAVhu31 (labeled hu.31 in alignment) [SEQ ID NO: 10] and AAVhu32 (marked hu.32 in alignment) [SEQ ID NO: 11]. Compared to AAV9, AAVhu31 and AAVhu32, two mutations (A67E and A157V) were considered critical in AAVhu68 and circulated in the FIGURE.
    [023] FIGURES 2A-2C provide an alignment of the nucleic acid sequence encoding the AAVhu68 vp1 capsid protein, with AAV9, AAVhu31 [SEQ ID NO: 12] and AAVhu32 [SEQ ID NO: 13].
    [024] FIGURES 3A-3B provide graphs showing the yields of AAVhu.68 compared to AAV9. The experiment was carried out as described in Example 2. n = 6. The P value was calculated and shown in the figures.
    [025] FIGURE 3A shows the yields of AAVhu.68 and AAV9 of the total lysate. The p-value was calculated as 0.4173 and determined to be non-significant.
    [026] FIGURE 3B shows the yields of AAVhu.68 and AAV9 from the culture supernatant. The yield of AAVhu.68 in the supernatant is significantly higher than that of AAV9 with a p value of 0.0003.
    [027] FIGURES 4A-4C provide immunohistochemical staining of various organs (heart, liver, lung and muscle) of mice administered with 5x10 11 GC AAVhu68.CB7.nl_acZ. The samples were
    Petition 870190107951, of 10/24/2019, p. 39/188
    12/144 prepared and processed as described in Example 3. The samples were contrasted with Eosin shown in red. A positive LacZ stain shown in blue indicates successful AAVhu68 transduction.
    [028] FIGURE 4A provides immunohistochemical staining of various organs (heart, liver, lung and muscle) of mice administered with 5x10 11 GC AAVhu68.CB7.nl_acZ intravenously (IV). All organs tested demonstrated transduction of AAVhu68, while tropism favorable to the heart and liver was observed on the lung and muscle.
    [029] FIGURE 4B provides immunohistochemical staining of various organs (heart, liver, lung and muscle) of mice administered with 5x10 11 GC AAVhu68.CB7.nl_acZ intramuscularly (IM). Heart, liver and muscle demonstrated a high rate of AAVhu68 transduction, while no detectable transduction in the lung was observed.
    [030] FIGURE 4C provides immunohistochemical staining of various organs (heart, liver, lung and muscle) of mice administered with 5x10 11 GC AAVhu68.CB7.nl_acZ intranasally (IN). Dispersed transduction was observed in the heart, liver, muscle and lung.
    [031] FIGURES 5A-5C provide fluorescent microscopic images of various regions of the brain (hippocampus, FIG 5A; motor cortex, FIG 5B; and cerebellum, FIG 5C) of mice administered with AAVhu68.GFP or AAV9.GFP at doses of 1x10 10 GC or 1x10 11 GC. The samples were prepared and processed as described in Example 4. A positive GFP signal shown in green indicates successful transduction of the AAV vectors.
    [032] FIGURE 5A provides fluorescent microscopic images of mice hippocampus slides administered with AAVhu68.GFP
    Petition 870190107951, of 10/24/2019, p. 40/188
    13/144 or AAV9.GFP in doses of 1x10 10 GC or 1x10 11 GC. Corresponding samples from untreated mice stained with nucleic acid dye shown in blue were provided as a negative control. The transduction of AAV vectors was observed in all samples tested, except one from mice injected with 1x10 10 GC of AAV9.GFP.
    [033] FIGURE 5B provides fluorescent microscopic images of the motor cortex of mice administered with AAVhu68.GFP or AAV9.GFP at doses of 1x10 1 ° GC or 1x10 11 GC. A better transduction of AAVhu68.GFP compared to that of AAV9 was observed.
    [034] FIGURE 5C provides fluorescent microscopic images of mouse cerebellum slides administered with AAVhu68.GFP or AAV9.GFP at doses of 1x10 1 ° GC or 1x10 11 GC. A successful transduction of AAVhu68. GFP was observed when the mice were injected with 1x10 11 GC of the vector.
    [035] FIGURES 6A-6D provide microscopic images of various organs (liver, kidney, heart and pancreas) of mice administered with AAVhu68.GFP intravenously. The samples were prepared and processed as described in Example 4. A positive GFP signal shown in green indicates successful transduction of said AAV vectors. Bright field images shown in black and white were provided for the organ's morphology, while the corresponding red fluorescent channel was provided as a negative control, when applicable.
    [036] FIGURE 6A provides microscopic images of a representative section of the liver of mice administered with AAVhu68.GFP intravenously. Positive sign shown in green was observed.
    [037] FIGURE 6B provides microscopic images of a representative renal section of mice administered with AAVhu68.GFP
    Petition 870190107951, of 10/24/2019, p. 41/188
    14/144 intravenously. Positive sign shown in green was observed.
    [038] FIGURE 6C provides microscopic images of a representative cardiac section of mice administered with AAVhu68.GFP intravenously. Positive sign shown in green was observed.
    [039] FIGURE 6D provides microscopic images of a section of the pancreas representative of mice administered with AAVhu68.GFP intravenously. Positive sign shown in green was observed.
    [040] FIGURE 7 is an image of a device for intracisternal delivery, including an optional introducer needle for the coaxial insertion method, which includes a 10 cc vector syringe, a 10 cc pre-filled discharge syringe, a set of T connector extension, a 22G x 5 spinal needle, an optional 18Gx3.5 introducer needle.
    [041] FIGURES 8A-8B illustrate the production yield for two different AAVhu68 vectors prepared on a small scale (FIG 8A) and on a very large scale (mega, FIG 8B) compared to vectors with different capsids. Data for small-scale vector preparations were generated using vectors with an AAVhu68, AAV9, AAV8 or AAV8 capsid and with a vector genome comprising a cytomegalovirus (CMV) promoter, a firefly and luciferase coding sequence an SV40 poly A (CMV.ffLuciferase.SV40). Mega-scale preparations were evaluated using the triple vectors AAVhu68, AAV9, AAV8 or AAV8 with a CMV promoter vector genome, an intron, an immunoadhesin coding sequence (201 Ig IA) and a SV40 poly A.
    [042] FIGURE 9 provides production purity for AAVhu68 vectors prepared on a mega scale compared to vectors with different capsids, including the triple AAV8, AAV9 and AAV8. The preparations
    Petition 870190107951, of 10/24/2019, p. 42/188
    15/144 were evaluated using AAVhu68, AAV9, AAV8 or AAV8 triple vectors with a vector genome comprising a CMV promoter, an intron, an immunoadhesin coding sequence (201 Ig IA) and a SV40 poly A.
    [043] FIGURES 10A -10B provide the expression level of the AAVhu68 vector transgene in male RAG KO mice (n = 5 / group) injected intramuscularly with 3x10 11 GC / mice (FIG 10A) or 3x10 10 GC / mouse (FIG 10B) of the vector compared to that of vectors with different capsids, including AAV8 triple, AAV9 and AAV8. The transgene expressed by the rAAV vectors is an immunoadhesin coding sequence (201 Ig IA). The Experiment was carried out as described in detail in Example 8.
    [044] FIGURES 11A-11B provide the expression level of the AAVhu68 vector transgene in the liver (FIG 11 A) or muscle (FIG 11B) of male C57BL / 6J mice (n = 5 / group) injected intramuscularly with 3x10 11 GC / mice of the vector compared to that of vectors with different capsids, including the triple AAV8, AAV9 and AAV8. The transgene expressed by the rAAV vectors is Vagalume luciferase. The Experiment was carried out as described in detail in Example 9.
    [045] FIGURE 12 provides the expression level of the AAVhu68 vector transgene in male and female cynomolgy monkeys injected intramuscularly with 1x10 13 GC / kg of vector weight compared to vectors with different capsids, including AAV8 triple, AAV9 and AAV8. The transgene expressed by the rAAV vectors is an immunoadhesin coding sequence (201 Ig IA). The Experiment was carried out as described in detail in Example 10.
    DETAILED DESCRIPTION OF THE INVENTION [046] Here are provided nucleic acid and amino acid sequences of a new isolated adenoassociated virus (AAV), which is called
    Petition 870190107951, of 10/24/2019, p. 43/188
    16/144 here AAVhu68, which is inside Clade F. AAVhu68 (formerly here AAV3G2) varies from another AAV9 Clade F virus (SEQ ID NO: 5) by two amino acids encoded in positions 67 and 157 of vp1, SEQ ID NO : 2. On the other hand, the other AAV Clade F (AAV9, hu31, hu31) have an Ala at position 67 and an Ala at position 157. New AAVhu68 capsids and / or manipulated AAV capsids with valine (Vai or V) at position 157 based on the numbering of SEQ ID NO: 2 and, optionally, a glutamic acid (Glu or E) at position 67. In certain embodiments, the ratio of vp3 proteins in the AAVhu68 capsid to vp1 and vp2 proteins it is smaller than that previously described for AAV9 capsids and another for Clade F of AAVs. In certain embodiments, the AAVhu68 capsid is composed of AAVhu68 vp1 proteins, AAVhu68 vp2 proteins and AAVhu68 vp3 proteins in a ratio of about 1 vp1: 1 to about 1.5 vp2: to 3 to about 10 vp3. In certain embodiments, a stock of rAAVhu68 virus or a population of rAAVhu68 is a composition that has an average of about 60 total vp 1, vp2 and vp3 proteins in the AAVhu68 capsid, which are present in the vp1: vp2: vp3 average ratio from 1: about 1: to about 3 to 6. These AAV capsids described here are useful for generating recombinant AAV vectors (rAAV) that are provided with good yield and / or packaging efficiency and provide rAAV vectors useful in the transduction of several different types of cells and tissues. Such cells and tissue types may include, without limitation, lung, heart, muscle, liver, pancreas, kidney, brain, hippocampus, motor cortex, cerebellum, nasal epithelial cells, cardiac muscle cells or cardiomyocytes, hepatocytes, pulmonary endothelial cells, myocytes lungs, epithelial cells, islet cells, acinar cells, renal cells and motor neurons.
    [047] A "recombinant AAV" or "rAAV" is a DNAse-resistant viral particle containing two elements, an AAV capsid and a genome
    Petition 870190107951, of 10/24/2019, p. 44/188
    17/144 vector containing at least non-AAV coding sequences packaged within the AAV capsid. Unless otherwise stated, this term can be used interchangeably with the phrase vector rAAV. RAAV is a replication-deficient virus or viral vector, as it does not have any functional AAV rep gene or functional AAV cap gene and cannot generate offspring. In certain embodiments, the only AAV sequences are the inverted terminal repeat sequences (ITRs) of AAV, typically located at the extreme 5 'and 3' ends of the vector genome, in order to allow the regulatory and gene sequences located between the ITRs are packaged inside the AAV capsid.
    [048] As used in this document, a vector genome refers to the nucleic acid sequence packaged within the rAAV capsid that forms a viral particle. Such a nucleic acid sequence contains repeated inverted AAV terminal sequences (ITRs). In the examples presented in this document, a vector genome contains at least 5 'to 3', an AAV 5 'ITR, coding sequence (s) and an AAV 3' ITR. AAV2 ITRs, an AAV of different origin than the capsid or that are not the complete ITRs can be selected. In certain embodiments, the ITRs are from the same AAV source as the AAV, which provides the rep function during production or a transcomplementary AAV. In addition, other ITRs can be used. In addition, the vector's genome contains regulatory sequences that direct the expression of gene products. The appropriate components of a vector genome are discussed in more detail in this document.
    [049] A rAAVhu68 consists of an AAVhu68 capsid and a vector genome. An AAVhu68 capsid is a collection of a heterogeneous population of vp1 proteins, a heterogeneous population of vp2 proteins and a heterogeneous population of vp3 proteins. As used in this document, when used to refer to proteins in the
    Petition 870190107951, of 10/24/2019, p. 45/188
    18/144 vp capsid, the heterogeneous term or any grammatical variation thereof, refers to a population consisting of elements that are not the same, for example, having vp1, vp2 or vp3 monomers (proteins) with different modified amino acid sequences . SEQ ID NO: 2 provides the encoded amino acid sequence of the AAVhu68 vp1 protein.
    [050] The AAVhu68 capsid contains subpopulations in vp1 proteins, vp2 proteins and vp3 proteins that have modifications from the amino acid residues provided for in SEQ ID NO: 2. These subpopulations include, at a minimum, certain asparagine residues (N or Asn) helpless. For example, certain subpopulations comprise at least one, two, three or four highly deamidated asparagine (N) positions in asparagine-glycine pairs in SEQ ID NO: 2 and optionally further comprising other deamidated amino acids, where deamidation results in a change amino acid and other optional modifications. SEQ ID NO: 14 provides an amino acid sequence from a modified AAVhu68 capsid, illustrating positions that may have some percentage of deamidated or otherwise modified amino acids. The various combinations of these and other modifications are described here.
    [051] As used in this document, a subpopulation of vp proteins refers to a group of vp proteins that has at least one characteristic defined in common and that consists of at least one member of the group less than all members of the group reference, unless otherwise specified. For example, a subpopulation of vp1 proteins is at least one (1) vp1 protein and less than all vp1 proteins in an assembled AAV capsid, unless otherwise specified. A subpopulation of vp3 proteins can be one (1) less vp3 protein than all vp3 proteins in an assembled AAV capsid, unless
    Petition 870190107951, of 10/24/2019, p. 46/188
    19/144 specified otherwise. For example, vp1 proteins can be a subpopulation of vp proteins; The vp2 proteins can be a separate subpopulation of vp proteins, and vp3 are still an additional subpopulation of vp proteins in an assembled AAV capsid. In another example, the vp1, vp2 and vp3 proteins may contain subpopulations with different modifications, for example, at least one, two, three or four highly deamidated asparagines, for example, in asparagine-glycine pairs.
    [052] Unless otherwise stated, highly deamidated refers to at least 45% deamidated, at least 50% deamidated, at least 60% deamidated, at least 65% deamidated, at least 70%, at least 75%, at least 80% , at least 85%, at least 90%, at least 95%, 97%, 99%, up to about 100% deamidated in a referenced amino acid position, compared to the amino acid sequence provided for in the reference amino acid position ( for example, at least 80% of the asparagines in amino acid 57 of SEQ ID NO: 2 can be deamidated based on the total vp1 proteins or 20% of the asparagines in amino acid 409 of SEQ ID NO: 2 can be deamidated based on the total protein vp1, vp2 and vp3). Such percentages can be determined using 2D gel, mass spectrometry techniques or other suitable techniques.
    [053] Without wishing to be bound by theory, it is believed that the deamidation of at least highly deamidated residues in the vp proteins in the AAVhu68 capsid is mainly non-enzymatic in nature, being caused by functional groups within the capsid protein that deamidate the selected asparagines and , to a lesser extent, glutamine residues. Efficient capsid assembly of most deamidating vp1 proteins indicates that these events occur after assembly of the capsid or that deamidation in individual monomers (vp1, vp2 or vp3) is well tolerated structurally and in
    Petition 870190107951, of 10/24/2019, p. 47/188
    20/144 a large part does not affect the assembly dynamics. Extensive deamidation in the exclusive region of VP1 (VP1 -u) (~ aa 1-137), generally considered to be located internally before cell entry, suggests that VP deamidation may occur prior to assembly of the capsid.
    [054] Without wishing to be bound by theory, the deamidation of N can occur when the nitrogen atom in the main chain of its C-terminal residue conducts a nucleophilic attack on the carbon atom of the amide group in the Asn side chain. Thus, it is believed that an intermediate ring-closed succinimide residue forms. The succinimide residue then conducts rapid hydrolysis to yield aspartic acid (Asp) or iso-aspartic acid (IsoAsp) to the final product. Therefore, in certain embodiments, the deamidation of asparagine (N or Asn) leads to an Asp or IsoAsp, which can interconvert via the succinimide intermediate, for example, as illustrated below.
    C '' OH ° rr ο · fo f NHj .jf I 'NH 3 r ; + Η1Ϊó i N iil / n — í Aspartic acid
    i) K Í -4: O 0 [o 0 | 2nd x
    Asparagine Intermediate Succinimidaf 3, A ,. Hello
    Y Y 2nd
    Iso-aspartic acid [055] As provided in this document, each deamidated N of SEQ ID NO: 2 can independently be aspartic acid (Asp), isoaspartic acid (isoAsp), aspartate and / or an interconversion mixture of Asp and isoAsp, or combinations thereof. Any suitable proportion of a- and isoaspartic acid can be present. For example, in certain embodiments, the ratio can be 10: 1 to 1:10 aspartic to iso-aspartic, about 50:50 aspartic: iso-aspartic or about 1: 3 aspartic: iso-aspartic, or another ratio selected.
    Petition 870190107951, of 10/24/2019, p. 48/188
    21/144 [056] In certain embodiments, one or more glutamine (Q) in SEQ ID NO: 2 deamide in glutamic acid (Glu), that is, a-glutamic acid, γ-glutamic acid (Glu) or a mixture of α and γ-glutamic acid, which can interconvert via a common glutarinimide intermediate. Any suitable proportion of a- and γ-glutamic acid can be present. For example, in certain embodiments, the ratio can be 10: 1 to 1:10 α to γ, about 50:50 α: γ, or about 1: 3 α: γ, or another selected ratio.
    Glutamic acid
    Ííí-G & Q
    Glutamine (Gin) Glutarimide intermediate
    Isoglutamic acid [057] Thus, a rAAVhu68 includes subpopulations in the rAAVhu68 capsid of the proteins vp1, vp2 and / or vp3 with deamidated amino acids, including at least one subpopulation comprising at least one highly deamidated asparagine. In addition, other modifications may include isomerization, particularly at selected aspartic acid (D or Asp) residue positions. In still other embodiments, the modifications may include an amidation in an Asp position.
    [058] In certain embodiments, an AAVhu68 capsid contains subpopulations of vp1, vp2 and vp3 having at least 4 to at least about 25 positions of deamidated amino acid residues, of which at least 1 to 10% are deamidated compared to
    Petition 870190107951, of 10/24/2019, p. 49/188
    22/144 encoded amino acid sequence of SEQ ID NO: 2. Most of these can be N-residues. However, Q residues can also be deamidated.
    [059] In certain embodiments, an AAV68 capsid is further characterized by one or more of the following. AAV hu68 capsid proteins comprise: AAVhu68 vp1 proteins produced by expression of a nucleic acid sequence encoding the predicted amino acid sequence 1 to 736 of SEQ ID NO: 2, vp1 proteins produced from SEQ ID NO: 1 or vp1 proteins produced from a nucleic acid sequence at least 70% identical to SEQ ID NO: 1 which encodes the predicted amino acid sequence 1 to 736 of SEQ ID NO: 2; AAVhu68 vp2 proteins produced by expression of a nucleic acid sequence encoding the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 2, vp2 proteins produced from a sequence comprising at least 412 nucleotides to 2211 of SEQ ID NO: 1 or vp2 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 412 to 2211 of SEQ ID NO: 1 which encode the predicted amino acid sequence of at least the amino acids 138 to 736 of SEQ ID NO: 2 and / or vp3 proteins of AAVhu68 produced by expression of a nucleic acid sequence encoding the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO: 2, proteins vp3 produced from a sequence comprising at least nucleotides 607 to 2211 of SEQ ID NO: 1 or vp3 proteins produced from a nucleic acid sequence at least 70% identical to at least in nucleotides 607 to 2211 of SEQ ID NO: 1 that encode the predicted amino acid sequence of at least approximately amino acids 203 to 736 of SEQ ID NO: 2.
    [060] Additionally or alternatively, a capsid is provided
    Petition 870190107951, of 10/24/2019, p. 50/188
    23/144
    AAV comprising a heterogeneous population of vp1 proteins optionally comprising a valine at position 157, a heterogeneous population of vp2 proteins optionally comprising a valine at position 157 and a heterogeneous population of vp3 proteins, wherein at least one subpopulation of vp1 and vp2 proteins comprise a valine at position 157 and optionally further comprise a glutamic acid at position 67 based on the numbering of the vp1 capsid of SEQ ID NO: 2. Additionally or alternatively, a capsid AAVhu68 is provided which comprises a heterogeneous population of vp1 proteins which are the product of a nucleic acid sequence that encodes the amino acid sequence of SEQ ID NO: 2, a heterogeneous population of vp2 proteins that are the product of a nucleic acid sequence that encodes the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 2 and a heterogeneous population of vp3 proteins that are the product of an acid sequence of the nucleic encoding at least amino acids 203 to 736 of SEQ ID NO: 2, where: vp1, vp2 and vp3 proteins contain subpopulations with amino acid modifications [061] AAVhu68 vp1, vp2 and vp3 proteins are typically expressed as variants alternative junctions encoded by the same nucleic acid sequence encoding the complete vp1 amino acid sequence of SEQ ID NO: 2 (amino acid 1 to 736). Optionally, the vp1 coding sequence is used alone to express the vp1, vp2 and vp3 proteins. Alternatively, this sequence can be coexpressed with one or more nucleic acid sequences encoding the AAVhu68vp3 amino acid sequence of SEQ ID NO: 2 (about aa 203 to 736) without the exclusive vp1 region (about aa 1 to about aa 137) and / or vp2-exclusive regions (about aa 1 to about aa 202), or a complementary strand thereto, the corresponding mRNA or tRNA (about nt 607 to about nt 2211 of SEQ ID NO: 1 ), or a
    Petition 870190107951, of 10/24/2019, p. 51/188
    24/144 sequence at least 70% to at least 99% (for example, at least 85%, at least 90%, at least 95%, at least 97%, at least 98% or at least 99%) identical to SEQ ID NO: 1 encoding aa 203 to 736 of SEQ ID NO: 2. Additionally, or alternatively, the vp1 coding sequence and / or vp2 coding can be coexpressed with the nucleic acid sequence encoding the amino acid sequence of AAVhu68vp2 of SEQ ID NO: 2 (about aa 138 to 736) without the exclusive vp1 region (about aa 1 to about 137), or a complementary strand to it, the corresponding mRNA or tRNA (nt 412 to 22121 of SEQ ID NO: 1) or a sequence of at least 70% to at least 99% (for example, at least 85%, at least 90%, at least 95%, at least 97%, at least 98% or at least 99 %) identical to SEQ ID NO: 1 encoding about aa 138 to 736 of SEQ ID NO: 2.
    [062] As described in this document, a rAAVhu68 has a rAAVhu68 capsid produced in a production system that expresses capsids of an AAVhu68 nucleic acid that encodes the vp1 amino acid sequence of SEQ ID NO: 2, and optionally additional acid sequences nucleic, for example, encoding a free vp3 protein from the exclusive vp1 and / or vp2 regions. The rAAVhu68 resulting from production using a single vp1 nucleic acid sequence produces heterogeneous populations of vp1 proteins, vp2 proteins and vp3 proteins. More particularly, the AAVhu68 capsid contains subpopulations in vp1 proteins, vp2 proteins and vp3 proteins that have modifications from the amino acid residues provided for in SEQ ID NO: 2. These subpopulations include, at a minimum, asparagine residues (N or Asn ) helpless. For example, asparagines in asparagine - glycine pairs are highly deamidated. [063] In one embodiment, the AA nucleic acid sequence
    Petition 870190107951, of 10/24/2019, p. 52/188
    25/144
    Vhu68vp1 has the sequence of SEQ ID NO: 1, or a complementary strand to it, for example, the corresponding mRNA or tRNA. In certain embodiments, the vp2 and / or vp3 proteins can be expressed additionally or alternatively from different nucleic acid sequences than vp1, for example, to change the proportion of vp proteins in a selected expression system. In certain embodiments, a nucleic acid sequence encoding the AAVhu68 vp3 amino acid sequence of SEQ ID NO: 2 (about aa 203 to 736) without the exclusive vp1 region (about aa 1 to about aa 137) is also provided ) and / or vp2-exclusive regions (about aa 1 to about aa 202), or a complementary strand thereto, the corresponding mRNA or tRNA (about nt 607 to about nt 2211 of SEQ ID NO: 1). In certain embodiments, a nucleic acid sequence encoding the AAVhu68 vp2 amino acid sequence of SEQ ID NO: 2 (about one to 138 to 736) is also provided without the exclusive vp1 region (about one to about 1 to about 137) or a complementary strand thereto, the corresponding mRNA or tRNA (nt 412 to 2211 of SEQ ID NO: 1).
    [064] However, other nucleic acid sequences encoding the amino acid sequence of SEQ ID NO: 2 can be selected for use in the production of rAAVhu68 capsids. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 1 or a sequence of at least 70% to 99% identical, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to SEQ ID NO: 1 encoding SEQ ID NO: 2. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 1 or a sequence at least 70% to 99%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% , identical to about nt
    Petition 870190107951, of 10/24/2019, p. 53/188
    26/144
    412 to about nt 2211 of SEQ ID NO: 1 encoding the vp2 capsid protein (about aa 138 to 736) of SEQ ID NO: 2. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of about nt 607 to about nt 2211 of SEQ ID NO: 1 or a sequence of at least 70% to 99%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% , at least 97%, at least 99%, identical to nt of SEQ ID NO: 1 encoding the capsid protein vp3 (about aa 203 to 736) of SEQ ID NO:
    2.
    [065] It is known in the art to design nucleic acid sequences that encode this AAVhu68 capsid, including DNA (genomic or cDNA) or RNA (for example, mRNA). In certain embodiments, the nucleic acid sequence encoding the AAVhu68vp1 capsid protein is provided in SEQ ID NO: 1. See also FIGURES 1B1 D. In other embodiments, a nucleic acid sequence from 70% to 99.9% of identity with SEQ ID NO: 1 can be selected to express AAVhu68 capsid proteins. In certain other embodiments, the nucleic acid sequence is at least about 75% identical, at least 80% identical, at least 85%, at least 90%, at least 95%, at least 97% identical, or at least 99 % to 99.9% identical to SEQ ID NO: 1. Such nucleic acid sequences can be codon-optimized for expression in a selected system (ie cell type) and can be designed by several methods. This optimization can be performed using methods that are available online (for example, GeneArt), published methods or a company that provides codon optimization services, for example, DNA2.0 (Menlo Park, CA). A method of codon optimization is described, for example, in US International Patent Publication No. WO 2015/012924, which is incorporated herein by reference in its entirety. See also, for example, the Patent Publication of
    Petition 870190107951, of 10/24/2019, p. 54/188
    27/144
    USA 2014/0032186 and US Patent Publication 2006/0136184. Suitably, the total length of the open reading frame (ORF) for the product is modified. However, in some modalities, only a fragment of the ORF can be changed. Using one of these methods, the frequencies can be applied to any polypeptide sequence and produce a nucleic acid fragment from a codon-optimized coding region encoding the polypeptide. Several options are available to make actual codon changes or to synthesize codon-optimized coding regions designed as described here. Such modifications or synthesis can be carried out using standard and routine molecular biological manipulations well known to those skilled in the art. In one approach, a series of pairs of complementary oligonucleotides of 80-90 nucleotides each in length and spanning the length of the desired sequence are synthesized using standard methods. These pairs of oligonucleotides are synthesized in such a way that after pairing, they form double-stranded fragments of 80-90 base pairs, containing cohesive ends, for example, each oligonucleotide in the pair is synthesized to extend 3, 4, 5, 6 , 7, 8, 9 10, or more bases in addition to the region that is complementary to the other oligonucleotide in par. The single-stranded ends of each oligonucleotide pair are designed to pair with the single-stranded end of another oligonucleotide pair. The oligonucleotide pairs are allowed to pair, and approximately five to six of these double-stranded fragments are then allowed to pair together through the single-stranded cohesive ends, and then are linked and cloned into a standard bacterial cloning vector, for example. example, a TOPO® vector available from Invitrogen Corporation, Carlsbad, California. The construct is then sequenced by standard methods. Several of these constructs consisting of 5 to 6 fragments of fragments from 80 to 90
    Petition 870190107951, of 10/24/2019, p. 55/188
    28/144 base pairs linked together, that is, fragments of about 500 base pairs, are prepared in such a way that the entire desired sequence is represented in a series of plasma constructs. The inserts of these plasmids are then cut with appropriate restriction enzymes and linked together to form the final construct. The final construct is then cloned into a standard bacterial cloning vector and sequenced. Additional methods would be immediately apparent to the person skilled in the art. In addition, genetic synthesis is readily available commercially.
    [066] In certain embodiments, asparagine (N) in the N-G pairs in the AAVhu68 vp1, vp2 and vp3 proteins is highly deamidated. In certain embodiments, an AAVhu68 capsid contains subpopulations of AAV capsid proteins vp1, vp2 and / or vp3 having at least four positions of asparagine (N) in AAVhu68 capsid proteins that are highly deamidated. In certain modalities, about 20 to 50% of the N-N pairs (exclusive of the N-N-N triplets) have deamidation. In certain embodiments, the first N is deamidated. In certain embodiments, the second N is deamidated. In certain embodiments, deamidation is between about 15% and about 25% deamidation. The deamidation in Q at position 259 of SEQ ID NO: 2 is from about 8% to about 42% of the AAVhu68 capsid proteins vp1, vp2 and vp3 of an AAVhu68 protein.
    [067] In certain embodiments, the rAAVhu68 capsid is further characterized by an amidation in D297 of the proteins vp1, vp2 and vp3. In certain embodiments, about 70% to about 75% of the D at position 297 of the vp1, vp2 and / or vp3 proteins in an AAVhu68 capsid are amidated, based on the numbering of SEQ ID NO: 2.
    [068] In certain modalities, at least one Asp in vp1, vp2 and / or vp3 of the capsid is isomerized in D-Asp. These isomers are generally present in less than about 1% of Asp
    Petition 870190107951, of 10/24/2019, p. 56/188
    29/144 in one or more residue positions 97, 107, 384, based on the numbering of SEQ ID NO: 2.
    [069] In certain embodiments, a rAAVhu68 has an AAVhu68 capsid with vp1, vp2 and vp3 proteins with subpopulations comprising combinations of one, two, three, four or more deamidated residues in the positions defined in the table below. Deamidation in rAAV can be determined using 2D gel electrophoresis and / or mass spectrometry and / or protein modeling techniques. Online chromatography can be performed with an Acclaim PepMap column and a Thermo UltiMate 3000 RSLC system (Thermo Fisher Scientific) coupled to a Q Exactive HF with a NanoFIex source (Thermo Fisher Scientific). MS data is acquired using a data-dependent top-20 method for the Q Exactive HF, dynamically choosing the most abundant precursor ions not yet sequenced from the survey scans (200-2000 m / z). The sequencing is performed through high energy collision dissociation fragmentation with a target value of 1 and 5 ions determined with automatic predictive gain control and precursor isolation was performed with a 4 m / z window. The exams were acquired with a resolution of 120,000 am / z 200. The resolution for the HCD spectra can be set to 30,000 am / z 200, with a maximum ion injection time of 50 ms and a normalized collision energy of 30.0 RF level of the S lens can be set to 50, to provide optimal transmission of the m / z region occupied by the peptides of the digested mass. Precursor ions with single, unassigned or six or more charge states can be excluded from the fragmentation selection. The BioPharma Finder 1.0 software (Thermo Fischer Scientific) can be used to analyze the acquired data. For peptide mapping, searches are performed using a FASTA database of single entry protein with a set of carbamidomethylation as a fixed modification; and oxidation, deamidation and phosphorylation
    Petition 870190107951, of 10/24/2019, p. 57/188
    30/144 adjusted as variable modifications, a mass accuracy of 10 ppm, a high protease specificity and a confidence level of 0.8 for MS / MS spectra. Examples of suitable proteases can include, for example, trypsin or chymotrypsin. Spectrometric identification of deamidated peptide masses is relatively simple, as deamidation increases the mass of the intact molecule +0.984 Da (the mass difference between the -OH and -NH2 groups). The percentage of deamidation of a particular peptide is the area of mass determined from the deamidated peptide divided by the sum of the area of the deamidated and native peptides. Considering the number of possible deamidation sites, isobaric species that are deamidated at different sites can migrate at a single peak. Consequently, fragment ions originating from peptides with multiple potential deamidation sites can be used to locate or differentiate multiple deamidation sites. In these cases, the relative intensities within the observed isotope patterns can be used to specifically determine the relative abundance of the different deamidated peptide isomers. This method assumes that the fragmentation efficiency for all isomeric species is the same and independent of the deamidation site. It will be understood by one skilled in the art that various variations of these illustrative methods can be used. For example, suitable mass spectrometers may include, for example, a quadrupole flight time mass spectrometer (QTOF), such as a Waters Xevo or Agilent 6530 or an orbitrap instrument, such as 0 Orbitrap Fusion or Orbitrap Velos (Thermo Fisher). Suitable liquid chromatography systems include, for example, the Acquity UPLC system of Waters or Agilent systems (1100 or 1200 series). Suitable data analysis software may include, for example, MassLynx (Waters), Pinpoint and Pepfinder (Thermo Fischer Scientific), Mascot (Matrix Science), Peaks DB (Bioinformatics Solutions). Still other techniques can be
    Petition 870190107951, of 10/24/2019, p. 58/188
    31/144 described, for example, in X. Jin et al, Hu Gene Therapy Methods, vol.
    28, No. 5, pp. 255-267, published online on June 16, 2017.
    DeamidationBased on Expected AAVHu68 [SEQ ID NO: 2] % Average based on VP1 / VP2 / VP3 proteins in AAVhu68 capsid Deamidated Waste + 1 (AA neighbor) Wide Range of Percentages (%) Narrow ranges (%) N57 (N-G) 78 to 100% 80 to 100, 85 to 97 N66 (N-E) 0a5 0, 1 to 5 N94 (N-H) 0 to 15, 0, 1 to 15, 5 to 12, 8 N113(N-L) 0a2 0, 1 to 2 -N253(N-N) 10 to 25 15 to 22 Q259(Q-i) 8 to 42 10 to 40, 20 to 35 -N270(N-D) 12 to 30 15 to 28 -N304(N-N) (position 303 also N) 0a5 1 a4 N319 (N-l) 0a5 0, 1 to 5, 1 to 3 N329 *(N-G) * (position 328 also N) 65 to 100 70 to 95.85 to 95.80 to 100,85 to 100, N336 (N-N) 0 to 100 0, 1 to 10, 25 to 100, 30 to100, 30 to 95 -N409(N-N) 15 to 30 20 to 25 N452(N-G) 75 to 100 80 to 100, 90 to 100, 95 to100, N477(N-Y) 0a8 0, 1 to 5 N512 (N-G) 65 to 100 70 to 95.85 to 95.80 to 100,85 to 100, -N515(N-S) 0 to 25 0, 1 to 10, 5 to 25, 15 to 25 -Q599 (Asn-Q-Gly) 1 to 20 2 to 20, 5 to 15
    Petition 870190107951, of 10/24/2019, p. 59/188
    32/144
    DeamidationBased on Expected AAVHu68 [SEQ ID NO: 2] % Average based on VP1 / VP2 / VP3 proteins in AAVhu68 capsid Deamidated Waste + 1 (AA neighbor) Wide Range of Percentages (%) Narrow ranges (%) N628(N-F) 0 to 10 0, 1 to 10, 2 to 8 N651(N-T) 0a3 0, 1 to 3 N663(N-K) 0a5 0, 1 a5, 2a4 N709(N-N) 0 to 25 0, 1 to 22, 15 to 25 N735 0 to 40 0, 1 to 35, 5 to 50, 20 to 35
    070] In certain embodiments, the AAVhu68 capsid is characterized by having capsid proteins in which at least 45% of the N residues are deamidated in at least one of the positions N57, N329, N452 and / or N512 based on the numbering of the amino acid sequence of SEQ ID NO: 2. In certain embodiments, at least about 60%, at least about 70%, at least about 80%, or at least 90% of the N residues in one or more of these NG positions (ie , N57, N329, N452 and / or N512, based on the amino acid sequence numbering of SEQ ID NO: 2) are deamidated. In these and other modalities, an AAVhu68 capsid is also characterized by having a population of proteins in which about 1% to about 20% of the N residues have deamidations in one or more positions: N94, N253, N270, N304, N409, N477 and / or Q599, based on the amino acid sequence numbering of SEQ ID NO: 2. In certain embodiments, AAVhu68 comprises at least one subpopulation of vp1, vp2 and / or vp3 proteins that are deamidated in one or more of the positions N35, N57, N66, N94, N113, N252, N253, Q259, N270, N303, N304. N305, N319, N328, N329, N336, N409, N410, N452, N477, N515, N598,
    Petition 870190107951, of 10/24/2019, p. 60/188
    33/144
    Q599, N628, N651, N663, N709, N735, based on the amino acid sequence numbering of SEQ ID NO: 2 or combinations thereof. In certain embodiments, capsid proteins may have one or more amidated amino acids.
    [071] Still other changes are observed, most of which do not result in the conversion of an amino acid to a different amino acid residue. Optionally, at least one Lys in the vp1, vp2 and vp3 of the capsid is acetylated. In certain embodiments, at least one Asp in vp1, vp2 and / or vp3 of the capsid is isomerized in D-Asp. Optionally, at least one S (Ser, Serine) in the vp1, vp2 and / or vp3 of the capsid is phosphorylated. Optionally, at least one T (Thr, Threonine) in the vp1, vp2 and / or vp3 of the capsid is phosphorylated. Optionally, at least one W (trp, tryptophan) in the vp1, vp2 and / or vp3 of the capsid is oxidized. Optionally, at least one M (Met, Methionine) in the vp1, vp2 and / or vp3 of the capsid is oxidized. In certain embodiments, capsid proteins have one or more phosphorylations. For example, certain vp1 capsid proteins can be phosphorylated at position 149.
    [072] In certain embodiments, an AAVhu68 capsid comprises a heterogeneous population of vp1 proteins that are the product of a nucleic acid sequence that encodes the amino acid sequence of SEQ ID NO: 2, wherein the vp1 proteins comprise a glutamic acid ( Glu) at position 67 and / or a valine (Vai) at position 157; a heterogeneous population of vp2 proteins optionally comprising a valine (Val) at position 157; and a heterogeneous population of vp3 proteins. The AAVhu68 capsid contains at least one subpopulation in which at least 65% of the asparagines (N) in asparagine - glycine pairs located at position 57 of the vp1 proteins and at least 70% of asparagines (N) in asparagine - glycine pairs at positions 329, 452 and / or 512 of the vp1, v2 and vp3 proteins are deamidated, based on the residue numbering of the amino acid sequence of the
    Petition 870190107951, of 10/24/2019, p. 61/188
    34/144
    SEQ ID NO: 2, where deamidation results in a change in amino acids. As discussed in more detail in this document, deamidated asparagines can be deamidated in aspartic acid, iso-aspartic acid, an aspartic acid / iso-aspartic acid interconverter or combinations thereof.
    [073] In certain embodiments, rAAVhu68 are further characterized by one or more of the following: (a) each of the vp2 proteins is independently the product of a nucleic acid sequence that encodes at least the vp2 protein of SEQ ID NO: 2 ; (b) each of the vp3 proteins is independently the product of a nucleic acid sequence that encodes at least the vp3 protein of SEQ ID NO: 2; (c) the nucleic acid sequence encoding the vp1 proteins is SEQ ID NO: 1, or a sequence of at least 70% to at least 99% (for example, at least 85%, at least 90%, at least 95 %, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 1, which encodes the amino acid sequence of SEQ ID NO: 2. Optionally, this sequence is used alone to express proteins vp1, vp2 and vp3. Alternatively, this sequence can be co-expressed with one or more nucleic acid sequences encoding the AAVhu68 vp3 amino acid sequence of SEQ ID NO: 2 (about aa 203 to 736) without the exclusive vp1 region (about aa 1 to about aa 137) and / or vp2-exclusive regions (about aa 1 to about aa 202), or a complementary strand thereto, the corresponding mRNA or tRNA (about nt 607 to about nt 2211 of SEQ ID NO: 1), or a sequence of at least 70% to at least 99% (for example, at least 85%, at least 90%, at least 95%, at least 97%, at least 98% or at least 99 %) identical to SEQ ID NO: 1 encoding aa 203 to 736 of SEQ ID NO: 2. Additionally, or alternatively, the vp1 coding sequence and / or vp2 coding can be coexpressed with the nucleic acid sequence encoding the sequence
    Petition 870190107951, of 10/24/2019, p. 62/188
    35/144 amino acids from vp2 of AAVhu68 of SEQ ID NO: 2 (about aa 138 to 736) without the exclusive region of vp1 (about aa 1 to about 137), or a complementary chain thereto, the mRNA or corresponding tRNA (nt 412 to 2211 of SEQ ID NO: 1) or a sequence of at least 70% to at least 99% (for example, at least 85%, at least 90%, at least 95%, at least 97%, at least 98% or at least 99%) identical to SEQ ID NO: 1 which encodes about aa 138 to 736 of SEQ ID NO: 2.
    [074] Additionally or alternatively, the rAAVhu68 capsid comprises at least one subpopulation of vp1, vp2 and / or vp3 proteins that are deamidated in one or more of the positions N57, N66, N94, N113, N252, N253, Q259, N270, N303 , N304, N305, N319, N328, N329, N336, N409, N410, N452, N477, N512, N515, N598, Q599, N628, N651, N663, N709, based on the numbering of SEQ ID NO: 2 or combinations of same; (e) the rAAVhu68 capsid comprises a subpopulation of vp1, vp2 and / or vp3 proteins comprising 1% to 20% deamidation in one or more of the positions N66, N94, N113, N252, N253, Q259, N270, N303, N304 , N305, N319, N328, N336, N409, N410, N477, N515, N598, Q599, N628, N651, N663, N709, based on the numbering of SEQ ID NO: 2 or combinations thereof; (f) the rAAVhu68 capsid comprises a subpopulation of vp1 in which 65% to 100% of the N at position 57 of the vp1 proteins are deamidated, based on the numbering of SEQ ID NO: 2; (g) the rAAVhu68 capsid comprises a subpopulation of vp1 proteins in which 75% to 100% of the N at position 57 of the vp1 proteins are deamidated; (h) the rAAVhu68 capsid comprises a subpopulation of vp1 proteins, vp2 proteins and / or vp3 proteins in which 80% to 100% of the N at position 329, based on the numbering of SEQ ID NO: 2, are deamidated; (i) the rAAVhu68 capsid comprises a subpopulation of vp1 proteins, vp2 proteins and / or vp3 proteins in which 80% to 100% of N at position 452, with
    Petition 870190107951, of 10/24/2019, p. 63/188
    36/144 based on the numbering of SEQ ID NO: 2, are deamidated; (j) the rAAVhu68 capsid comprises a subpopulation of vp1 proteins, vp2 proteins and / or vp3 proteins in which 80% to 100% of the N in position 512, based on the numbering of SEQ ID NO: 2, are deamidated; (k) rAAV comprises about 60 total capsid proteins in a ratio of about 1 vp1 to about 1 to 1.5 vp2 to 3 to 10 vp3 proteins; (I) the rAAV comprises about 60 total capsid proteins in a ratio of about 1 vp1 to about 1 vp2 to 3 to 9 vp3 proteins.
    [075] In certain embodiments, AAVhu68 is modified to alter glycine in an asparagine-glycine pair in order to reduce deamidation. In other embodiments, asparagine is changed to a different amino acid, for example, a glutamine that deaminates at a slower rate; or to an amino acid that lacks amide groups (for example, glutamine and asparagine contain amide groups); and / or an amino acid that lacks amine groups (for example, lysine, arginine and histidine contain amide groups). As used herein, amino acids that lack amide or amine side groups refer to, for example, glycine, alanine, valine, leucine, isoleucine, serine, threonine, cystine, phenylalanine, tyrosine or tryptophan and / or proline. Modifications such as those described may be in one, two or three of the asparagine-glycine pairs found in the AAVhu68 encoded amino acid sequence. In certain embodiments, these modifications are not made in all four pairs of asparagine - glycine. Thus, a method to reduce the deamidation of AAVhu68 and / or variants of AAVhu68 manipulated with lower deamidation rates. Additionally or alternatively, one or more other starch amino acids can be changed to a non-amide amino acid to reduce the deamidation of AAVhu68.
    [076] These amino acid modifications can be made by conventional genetic manipulation techniques. For example, you can
    Petition 870190107951, of 10/24/2019, p. 64/188
    37/144 a nucleic acid sequence containing modified AAVhu68 codons can be generated, in which one to three of the codons encoding glycine at position 58, 330, 453 and / or 513 in SEQ ID NO: 2 (argininaglycine pairs) are modified to encode an amino acid other than glycine. In certain embodiments, a nucleic acid sequence containing modified arginine codons can be manipulated in one to three of the arginine-glycine pairs located at position 57, 329, 452 and / or 512 in SEQ ID NO: 2, so that modified codon encodes an amino acid other than arginine. Each modified codon can encode a different amino acid. Alternatively, one or more of the altered codons can encode the same amino acid. In certain embodiments, these modified AAVhu68 nucleic acid sequences can be used to generate a mutant rAAVhu68 having a capsid with less deamidation than the native hu68 capsid. Such a mutant rAAVhu68 may have reduced immunogenicity and / or increased stability during storage, particularly storage in the form of suspension. As used in this document, a codon refers to three nucleotides in a sequence that encodes an amino acid.
    [077] As used in this document, encoded amino acid sequence refers to the amino acid that is predicted based on the translation of a known DNA codon from a referenced nucleic acid sequence being translated into an amino acid. The following table illustrates the DNA codons and twenty common amino acids, showing the one-letter code (SLC) and the three-letter code (3LC).
    Amino Acid SLC 3 LC | Codons of DNA | Isoleucine 1 lie ATT. ATC. ATA Leucine L Read CTT. CTC. CTA. CTG. TTA. TTG Valina V Go GTT. GTC. GTA. GTG] Phenylalanine F Phe TTT. TTC]
    Petition 870190107951, of 10/24/2019, p. 65/188
    38/144
    (MethionineCystine MÇ MetCys ATG üTGT. TGC) (Alanine THE Allah GCT. GCC. GCÁ. GCG ([ (Glycine G Gly GGT.GGC.GGA.GGG | (Proline P Pro CCT ccc CCA CCG ] jTreonina T Thr ACT, ACC. A CA. ÀCG (j (Serina s To be TCT TCC TCA TCG AGT AGC ] ΠΊ resin Y Tyr TAT, TÁC ii (Tryptophan W Trp tgg 1 Glutamine Q Gin CAA. CAG] (Asparagine N Asn ÁAT. ÃÁC j (Histidine H His CAT. CAC] [Glutamic acid AND Glu GAS. GAS II (Aspartic acid D Âsp GAT. GAC] (Lysine k Lys AAA. THE AG ] (Arginine R Arg CGT. CGC. CGA. CGG. AGA, AGG (j Stop codons StopTAA. TAG. TGA]
    [078] AAVhu68 capsids may be useful in certain modalities. For example, these capsids can be used in the generation of monoclonal antibodies and / or in the generation of reagents useful in assays to monitor levels of AAVhu68 concentration in gene therapy patients. Techniques for generating useful anti-AAVhu68 antibodies, labeling such empty antibodies or capsids and suitable assay formats are known to those skilled in the art.
    [079] In certain embodiments, a nucleic acid sequence of SEQ ID NO: 1 or a sequence of at least 70%, at least 75%, at least 80%, at least 85%, at least 90% is provided here, at least 95%, at least 97%, at least 99%, which encodes the vp1 amino acid sequence of SEQ ID NO: 2 with a modification (for example, deamidated amino acid) as described herein. In certain embodiments, the amino acid sequence vp1 is reproduced in SEQ ID NO: 14.
    Petition 870190107951, of 10/24/2019, p. 66/188
    39/144 [080] As used in this document, the term Clade, when referring to AAV groups, refers to an AAV group that are phylogenetically related to each other, as determined using a Neighbor-Joining algorithm for a value initialization of at least 75% (of at least 1000 replicates) and a measurement of the Poisson correction distance of at most 0.05, based on the alignment of the AAV vp1 amino acid sequence. The Neighbor-Joining algorithm has been previously described in the literature. See, for example, M. Nei and S. Kumar, Molecular Evolution and Phylogenetics (Oxford University Press, New York (2000)). Computer programs are available that can be used to implement this algorithm. For example, the MEGA v2.1 program implements the modified Nei-Gojobori method. Using these techniques and computer programs, and the sequence of an AAV vp1 capsid protein, one skilled in the art can readily determine whether a selected AAV is contained in one of the Clades identified in this document, or in another Clade. Clade s. See, for example, G Gao, et al, J Virol, 2004 Jun; 78 (10: 6381-6388, which identifies Clades s A, B, C, D, E and F, and provides nucleic acid sequences from the new AAV, GenBank accession numbers AY530553 to AY530629. See also WO 2005/033321 .
    [081] In one embodiment, the invention provides a engineered molecule comprising a spacer sequence between the AAVhu68 vp1 coding sequence and the AAVhu68 rep coding sequences. This coding sequence is: atgacttaaaccaggt, SEQ ID NO: 9. The coding sequence for rep52 of AAVhu68 is reproduced in SEQ ID NO: 3. The sequence of the rep52 protein is reproduced in SEQ ID NO: 4.
    [082] In one embodiment, a method is provided to increase the yields of an rAAV and thus increase the amount of an rAAV that is present in the supernatant before or without the need
    Petition 870190107951, of 10/24/2019, p. 67/188
    40/144 cell lysis. This method involves manipulating an AAV VP1 capsid gene to express a capsid protein with Glu at position 67, not Vai at position 157 based on an alignment with the amino acid numbering of the AAVhu68 vp1 capsid protein . In other modalities, the method involves manipulating a VP1 capsid gene from AAVhu68 to express a capsid protein with Vai at position 157, and not Glu at position 67. This other AAV can be easily selected from another AAV Clade F or AAV in Clade A, B, C, D or E. In certain modalities, AAV is selected from Clade C, D, E or F. In other modalities, AAV is selected from Clade C, D or E .
    [083] In other modalities, the method involves increasing the yield of an rAAV and thus increasing the amount of an rAAV that is present in the supernatant before or without the need for cell lysis. This method involves manipulating an AAV VP1 capsid gene to express a capsid protein with Glu at position 67, Val at position 157, or both based on an alignment with the amino acid numbering of the AAVhu68 vp1 capsid protein. In other embodiments, the method involves manipulating the VP2 capsid gene to express a capsid protein with Vai at position 157. In still other embodiments, rAAV has a modified capsid comprising capsid proteins vp1 and vp2 Glu at position 67 and Go to position 157.
    [084] In still other modalities, AAVhu68 can be manipulated to have a Ser, Gly, Ser or Thr in position 67, with reference to the numbering vp1 [SEQ ID NO: 2], keeping Vai in position 157. In still others modalities, AAVhu68 can be manipulated to have a lie or Leu at position 157, with reference to the numbering of vp1 [SEQ ID NO: 2]. In yet another embodiment, AAVhu68 can be manipulated to have a Ser, Gly, Ser or Thr in position 67 and a lie or
    Petition 870190107951, of 10/24/2019, p. 68/188
    41/144
    It read in position 157, with reference to the numbering vp1 [SEQ ID NO: 2]. [085] In an additional embodiment, a method for packaging a transgene into an AAV Clade F that provides at least a 15% increase in the yield of the packaged vector compared to AAV9, said method comprising: cultivating a cell culture hostesses according to suitable conditions. In certain embodiments, the increase is at least a 90% increase in income. In other modalities, the increase is an increase of at least 200% in income.
    [086] In a comparison between AAVhu68 and AAVrhIO, it was found that AAVhu68 provides better transduction efficiency than AAVrhIO at low doses (for example, about 1 x 10 9 GC) after intracerebroventricular administration. In a further comparison between AAVhu68 and AAV9, it was found that AAVhu68 provides better transduction efficiency than AAV9 in the cerebellum, motor cortex and hippocampus of the brain (for example, about 1 x 10 11 GC) after intracerebroventricular administration.
    [087] In certain embodiments, the invention provides an AAVhu68 vector comprising a vector genome that expresses an antibody directed against an HER2 receptor. This vector is useful in the treatment and / or prevention of cancers.
    [088] As used in this document, an AAV9 capsid is a self-assembled AAV capsid composed of several AAV9 vp proteins. AAV9 vp proteins are typically expressed as alternative junction variants encoded by a nucleic acid sequence of SEQ ID NO: 5 or a sequence of at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to it, which encodes the vp1 amino acid sequence of SEQ ID NO: 6 (GenBank access: AAS99264). These junction variants result in proteins of different lengths
    Petition 870190107951, of 10/24/2019, p. 69/188
    42/144 of SEQ ID NO: 6. In certain embodiments, “AAV9 capsid” includes an AAV with an amino acid sequence that is 99% identical to AAS99264 or 99% identical to SEQ ID NO: 6. See also US7906111 and WO 2005 / 033321. As used herein, variants of AAV9 include those described in, for example, WQ2016 / 049230, US 8,927,514, US 2015/0344911 and US 8,734,809.
    [089] Methods for generating capsids, and therefore coding sequences, and methods for producing viral rAAV vectors have been described. See, for example, Gao, et al, Proc. Natl. Acad. Sci. U.S.A. 100 (10), 6081-6086 (2003) and US 2013 / 0045186A1.
    [090] The term substantial homology or substantial similarity, when referring to a nucleic acid, or fragment thereof, indicates that, when ideally aligned with appropriate nucleotide insertions or deletions or deletions with another nucleic acid (or its complementary strand) , there is a nucleotide sequence identity in at least about 95 to 99% of the aligned sequences. Preferably, the homology is over the complete sequence, or an open reading frame of the same, or another suitable fragment that is at least 15 nucleotides in length. Examples of suitable fragments are described here.
    [091] The terms "sequence identity", "percentage of sequence identity" or "identical percentage" in the context of nucleic acid sequences refer to residues in the two sequences that are the same when aligned for maximum match. The length of the sequence identity comparison can be over the entire length of the genome, the total length of a gene coding sequence, or a fragment of at least about 500 to 5000 nucleotides, is desired. However, the identity between smaller fragments, for example, of at least about nine nucleotides, usually at least about 20 to 24 nucleotides,
    Petition 870190107951, of 10/24/2019, p. 70/188
    43/144 at least about 28 to 32 nucleotides, at least about 36 or more nucleotides, may also be desired. Likewise, the percentage of sequence identity can be readily determined for amino acid sequences, over the entire length of a protein or a fragment thereof. Suitably, a fragment is at least about 8 amino acids in length and can be up to about 700 amino acids. Examples of suitable fragments are described here.
    [092] The term substantial homology or substantial similarity, when referring to amino acids or fragments thereof, indicates that, when perfectly aligned with appropriate amino acid insertions or deletions with another amino acid (or its complementary chain), there is an identity amino acid sequence in at least about 95 to 99% of the aligned sequences. Preferably, the homology is about the complete sequence, or a protein thereof, for example, a cap protein, a rep protein, or a fragment thereof, at least 8 amino acids, or more desirable, at least 15 amino acids in length. Examples of suitable fragments are described here.
    [093] The term highly conserved means at least 80% identity, preferably at least 90% identity and, more preferably, more than 97% identity. Identity is readily determined by one skilled in the art, using algorithms and computer programs known to those skilled in the art.
    [094] Generally, when referring to "identity", "homology" or "similarity" between two different adenoassociated viruses, "identity", "homology" or "similarity" is determined in reference to "aligned" sequences. "Aligned" sequences or "alignments" refer to sequences of multiple nucleic acids or protein sequences
    Petition 870190107951, of 10/24/2019, p. 71/188
    44/144 (amino acids), often containing corrections for missing or additional bases or amino acids compared to a reference sequence. In the examples, AAV alignments are performed using the published AAV9 sequences as a reference point. Alignments are performed using any of the multiple publicly or commercially available Multiple Sequence Alignment Programs. Examples of such programs include "Clustal Omega", "Clustal W", "CAP Sequence Assembly", "MAP" and "MEME", which are accessible via web servers on the Internet. Other sources for such programs are known to those skilled in the art. Alternatively, NTI vector utilities are also used. There are also several algorithms known in the art that can be used to measure nucleotide sequence identity, including those contained in the programs described above. As another example, polynucleotide sequences can be compared using Fasta ™, a program in GCG Version 6.1. Fasta ™ provides alignments and sequence identity percentages for regions of the best overlap between query and search strings. For example, the percentage sequence identity between the nucleic acid sequences can be determined using Fasta ™ with its standard parameters (a word size of 6 and the NOPAM factor for the scoring matrix) as provided in GCG Version 6.1, incorporated in this document by reference. Multiple sequence alignment programs are also available for amino acid sequences, for example, “Clustal Omega”, “Clustal X”, “MAP”, “PIMA,“ MAS ”,“ BLOCKMAKER ”,“ MEME ”and“ Match Box ”. Generally, any of these programs are used in the default settings, although one skilled in the art can change these settings as needed. Alternatively, one skilled in the art can use another algorithm or computer program that provides at least the same level of identity or alignment as
    Petition 870190107951, of 10/24/2019, p. 72/188
    45/144 that provided by the referenced algorithms and programs. See, for example, J.D. Thomson et al, Nucl. Acids. Res., “A comprehensive comparison of multiple sequence alignments”, 27 (13): 2682-2690 (1999).
    I. rAAV Vectors [095] As indicated above, the new AAVhu68 sequences and proteins are useful in the production of rAAV and are also useful in recombinant AAV vectors that can be antisense delivery vectors, gene therapy vectors or vaccine vectors. In addition, the manipulated AAV capsids described herein, for example, those with mutant amino acids at position 67, 157 or both in relation to the numbering of the vp1 capsid protein in SEQ ID NO: 2, can be used to manipulate rAAV vectors for the delivery of a number of nucleic acid molecules suitable for targeting cells and tissues.
    [096] Genomic sequences that are packaged in an AAV capsid and delivered to a host cell are typically composed of at least one transgene and its regulatory sequences and inverted AAV terminal repeats (ITRs). Single-stranded AAV and self-complementary AAV (sc) are covered by rAAV. The transgene is a nucleic acid coding sequence, heterologous to vector sequences, which encodes a polypeptide, protein, functional RNA molecule (for example, miRNA, miRNA inhibitor) or other genetic product of interest. The nucleic acid coding sequence is operably linked to regulatory components in a manner that allows transcription, translation and / or expression of the transgene in a cell of a target tissue.
    [097] The vector AAV sequences typically comprise the 5 'and 3' cis-inverted terminal repeat sequences (see, for example, BJ Carter, in the Handbook of Parvoviruses, ed., P. Tijsser, CRC Press, pp. 155 168 (1990)). ITR sequences are about
    Petition 870190107951, of 10/24/2019, p. 73/188
    46/144 of 145 bp in length. Preferably, substantially, all sequences encoding the ITRs are used in the molecule, although some minor modification of these sequences is allowed. The ability to modify these ITR sequences is within the skill of the art. (See, for example, texts such as Sambrook et al, Molecular Cloning. A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory, New York (1989); and K. Fisher et al., J. Virol., 70: 520 532 (1996)). An example of such a molecule employed in the present invention is a cis-acting plasmid containing the transgene, in which the sequence of selected transgenes and the associated regulatory elements are flanked by the AAV 5 'and 3' ITR sequences. In one embodiment, the ITRs are of a different AAV than the one that provides a capsid. In one embodiment, the AAV2 ITR sequences. An abbreviated version of the ITR 5 ', called AITR, has been described, in which the terminal resolution location (trs) and the D sequence are excluded. In other modalities, complete 5 'and 3' AAV ITRs are used. However, an AAV can be selected from other suitable sources. When the source of the ITRs comes from AAV2 and the AAV capsid is from another source of AAV, the resulting vector can be called pseudotyped. However, other configurations of these elements may be appropriate.
    [098] In addition to the main elements identified above for the recombinant AAV vectors, the vector also includes necessary conventional control elements that are operatively linked to the transgene in a way that allows for its transcription, translation and / or expression in a cell transfected with the plasmid vector or infected with the virus produced by the invention. As used herein, operably linked sequences include both expression control sequences that are contiguous to the gene of interest and expression control sequences that act trans or at a distance to control the gene of interest.
    Petition 870190107951, of 10/24/2019, p. 74/188
    47/144 [099] The regulatory control elements typically contain a promoter sequence as part of the expression control sequences, for example, located between the selected ITR 5 'sequence and the coding sequence. Constitutive promoters, adjustable promoters [see, for example, WO 2011/126808 and WO 2013/04943], tissue-specific promoters, or a promoter responsive to physiological stimuli can be used in the vectors described in this document. The promoter (s) can be selected from different sources, for example, immediate and early human cytomegalovirus (CMV) enhancer / promoter, SV40 early promoter / enhancer, JC polymovirus promoter, protein myelin basic (MBP) or glial fibrillary acid protein (GFAP) promoters, promoter associated with herpes simplex virus (HSV-1) (LAP) latency, long terminal repeat (LTR) promoter of malignant sarcoma virus (RSV) , neuron-specific promoter (NSE), platelet-derived growth factor (PDGF) promoter, hSYN, melanin-concentrating hormone (MCH) promoter, CBA, matrix metalloprotein (MPP) promoter and beta-actin promoter chicken. In addition to a promoter, a vector may contain one or more other appropriate initiation, termination, transcription enhancer sequences, efficient RNA processing signals, such as splice and polyadenylation (polyA) signals; sequences that stabilize cytoplasmic mRNA, for example, WPRE; sequences that increase translation efficiency (ie, Kozak consensus sequence); sequences that improve protein stability; and when desired, sequences that increase the secretion of the encoded product. An example of a suitable intensifier is the CMV intensifier. Other suitable enhancers include those that are appropriate for the desired target tissue indications. In one embodiment, the expression cassette comprises one or more expression enhancers. In one embodiment, the expression cassette contains two or more
    Petition 870190107951, of 10/24/2019, p. 75/188
    48/144 expression intensifiers. These intensifiers can be the same or they can differ from each other. For example, an intensifier may include an immediate early CMV intensifier. This intensifier can be present in two copies that are located adjacent to each other. Alternatively, the double copies of the enhancer can be separated by one or more sequences. In yet another embodiment, the expression cassette also contains an intron, for example, the chicken beta-actin intron. Other suitable introns include those known in the art, for example, as described in WO 2011/126808. Examples of suitable polyA sequences include, for example, SV40, SV50, bovine growth hormone (bGH), human growth hormone and synthetic polyAs. Optionally, one or more sequences can be selected to stabilize the mRNA. An example of such a sequence is a modified WPRE sequence, which can be manipulated upstream of the polyA sequence and downstream of the coding sequence [see, for example, MA Zanta-Boussif, et al., Gene Therapy (2009) 16: 605- 619.
    [100] These rAAVs are particularly suitable for delivering genes for therapeutic purposes and for immunization, including the induction of protective immunity. In addition, the compositions of the invention can also be used for the production of a desired gene product in vitro. For in vitro production, a desired product (for example, a protein) can be obtained from a desired culture after transfecting the host cells with an rAAV containing the molecule encoding the desired product and cultivating the cell culture under conditions that allow expression. The expressed product can then be purified and isolated, as desired. Suitable techniques for transfection, cell culture, purification and isolation are known to those skilled in the art.
    [101] In certain embodiments, an rAAV or composition as here
    Petition 870190107951, of 10/24/2019, p. 76/188
    49/144 provided does not contain an anti-influenza antibody or immunoglobulin construct. In certain embodiments, an rAAV or composition as provided herein does not contain an SMN coding sequence.
    Therapeutic Genes and Genetic Products [102] Useful products encoded by the transgene include a variety of gene products that replace a defective or defective gene, inactivate or "knock-out", or "knock-down" or reduce the expression of a gene that is expressing itself at a high undesirable level, or delivering a genetic product that has a desired therapeutic effect. In most modalities, the therapy will be somatic gene therapy, that is, transferring genes to a cell in the body that does not produce sperm or eggs. In certain embodiments, transgenes expressing proteins have the sequence of native human sequences. However, in other modalities, synthetic proteins are expressed. Such proteins can be used for the treatment of human beings, or in other modalities, designed for the treatment of animals, including pets, such as populations of dogs or cats, or for the treatment of animals or other animals that come into contact with populations human.
    [103] Examples of suitable genetic products may include those associated with familial hypercholesterolemia, muscular dystrophy, cystic fibrosis and rare or orphan diseases. Examples of such rare diseases may include spinal muscular atrophy (SMA), Huntingdon's disease, Rett syndrome (for example, methyl-CpG binding protein 2 (MeCP2); UniProtKB - P51608), amyotrophic lateral sclerosis (ALS), dystrophy Duchenne type muscle, Friedrichs' ataxia (eg frataxin), progranulin (PRGN) (associated with non-Alzheimer's brain degenerations, including frontotemporal dementia (FTD), non-fluent progressive aphasia (PNFA) and semantic dementia), among or
    Petition 870190107951, of 10/24/2019, p. 77/188
    50/144 portions. See, for example, www.orpha.net/consor/cgi-bin/Disease_SearchJJst.php; rarediseases.info.nih.gov/diseases.
    [104] Examples of suitable genes may include, for example, hormones and growth and differentiation factors, including, without limitation, insulin, glucagon, glucagon-like peptide (GLP1), growth hormone (GH), parathyroid hormone ( PTH), growth hormone releasing factor (GRF), follicle stimulating hormone (FSH), luteinizing hormone (LH), human chorionic gonadotropin (hCG), vascular endothelial growth factor (VEGF), angiopoietins, angiostatin, stimulating factor granulocyte colonies (GCSF), erythropoietin (EPO) (including, for example, human, canine or feline epo), connective tissue growth factor (CTGF), neutrophic factors, including, for example, basic fibroblast growth factor ( bFGF), fibroblast acid growth factor (aFGF), epidermal growth factor (EGF), platelet-derived growth factor (PDGF), insulin growth factors I and II (IGF-I and IGF-II), any one of the superfamily transforming growth factor a, including TGFα, activins, inhibins or any of the bone morphogenic proteins (BMP) BMPs 1-15, any of the heregluin / neuregulin / ARIA / neu differentiation factor family (NDF) ), nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophins NT-3 and NT-4/5, ciliary neurotrophic factor (CNTF), neurotrophic factor derived from the glial cell line (GDNF), neurturin , agrina, anyone from the semaphorin / collapsin family, netrin-1 and netrin-2, hepatocyte growth factor (HGF), ephrins, noggin, sonic hedgehog and tyrosine hydroxylase.
    [105] Other useful products of the transgene include proteins that regulate the immune system, including, without limitation, cytokines and lymphokines, such as thrombopoietin (TPO), interleukins (IL) IL-1 to IL-36 (including, for example, human interleukins IL-1, IL-1 a, IL-1 β, IL-2, IL-
    Petition 870190107951, of 10/24/2019, p. 78/188
    51/144
    3, IL-4, IL-6, IL-8, IL-12, IL-11, IL-12, IL-13, IL-18, IL-31, IL-35), monocyte chemoprotein protein, inhibitory factor leukemia, granulocyte and macrophage colony stimulating factor, Fas ligand, tumor necrosis factors a and β, interferons α, β and γ, stem cell factor, stem cell factor, flk-2 / flt3 ligand. The gene products produced by the immune system are also useful in the invention. These include, but are not limited to, IgG, IgM, IgA, IgD and IgE immunoglobulins, chimeric immunoglobulins, humanized antibodies, single chain antibodies, T cell receptors, chimeric T cell receptors, single chain T cell receptors, MHC class molecules I and class II, as well as engineered immunoglobulins and MHC molecules. For example, in certain embodiments, rAAV antibodies can be engineered to provide canine or feline antibodies, for example, as anti-IgE, antiIL31, anti-CD20, anti-NGF, anti-GnRH. Useful gene products also include complement regulatory proteins, such as complement regulatory proteins, membrane cofactor protein (MCP), decline accelerator factor (DAF), CR1, CF2, CD59 and C1 esterase inhibitor (C1-INH).
    [106] Still other useful genetic products include any of the hormone receptors, growth factors, cytokines, lymphokines, regulatory proteins and immune system proteins. The invention encompasses receptors for cholesterol regulation and / or lipid modulation, including the low density lipoprotein (LDL) receptor, high density lipoprotein (HDL) receptor, the very low density lipoprotein receptor (VLDL) and scavenger receptors . The invention also encompasses genetic products, such as members of the steroid hormone receptor superfamily, including glucocorticoid receptors and estrogen receptors, vitamin D receptors and other nuclear receptors. In addition, useful genetic products include transcription factors such as jun, fos, max, mad, response factor
    Petition 870190107951, of 10/24/2019, p. 79/188
    Serum 52/144 (SRF), AP-1, AP2, myb, MyoD and myogenin, box-containing proteins of ETS, TFE3, E2F, ATF1, ATF2, ATF3, ATF4, ZF5, NFAT, CREB, HNF-4, C / EBP, SP1, CCAAT box binding proteins, interferon regulatory factor (IRF-1), Wilms tumor protein, ETS binding protein, GATA box binding proteins, STAT, for example, GATA-3 , and the forkhead family of winged helix proteins.
    [107] Other useful genetic products include carbamoyl synthase I, ornithine transcarbamylase (OTC), arginosuccinate synthase, arginosuccinate lyase (ASL) for the treatment of arginosuccinate lyase deficiency, arginase, fumarylacetate hydrolase, phenylalanine hydroxylase, alpha-1-antitrips -rhesus fetoprotein (AFP), rhesus chorionic gonadotropin (CG), glucose-6-phosphatase, porphobilinogen deaminase, cystathionine beta synthase, branched-chain keto acid decarboxylase, albumin, isovaleryl-coA dehydrogenase, propionyl Coionyl malonyl-CoA mutase, glutaryl-CoA dehydrogenase, insulin, beta-glucosidase, pyruvate-carboxylate, liver phosphorylase, phosphorylase-kinase, glycine decarboxylase, protein H, protein T, a cystic fibrosis transmembrane regulator (CFTR) gene and a gene dystrophin [for example, a mini- or micro-dystrophin]. Still other useful genetic products include enzymes that may be useful in enzyme replacement therapy, which is useful in various conditions resulting from deficient enzyme activity. For example, enzymes containing mannose-6-phosphate can be used in therapies for lysosomal storage diseases (for example, a suitable gene includes one that encodes β-glucuronidase (GUSB)).
    [108] In certain embodiments, rAAV can be used in gene editing systems, which may involve an rAAV or co-administering multiple rAAV stocks. For example, rAAV can be manipulated to provide SpCas9, SaCas9, ARCUS, Cpf 1 and others
    Petition 870190107951, of 10/24/2019, p. 80/188
    53/144 suitable gene editing constructs.
    [109] Still other useful genetic products include those used for the treatment of hemophilia, including hemophilia B (including factor IX) and hemophilia A (including factor VIII and its variants, such as the light chain and the heavy chain of the heterodimer and the excluded domain B: US Patent No. 6,200,560 and US Patent No. 6,221,349). In some embodiments, the minigene comprises 57 first base pairs of the Factor VIII heavy chain that encodes the 10 amino acid signal sequence, as well as the polyadenylation sequence of human growth hormone (hGH). In alternative modalities, the minigene also comprises domains A1 and A2, as well as 5 amino acids of the N-terminal of domain B and / or 85 amino acids of the C-terminal of domain B, as well as Domains A3, C1 and C2. In yet other embodiments, the Factor VIII heavy chain and light chain encoding nucleic acids are supplied in a single minigene separated by 42 nucleic acids encoding 14 domain B amino acids [US Patent No. 4,247,211, US]. 6,200,560], [110] Other useful genetic products include non-naturally occurring polypeptides, such as chimeric or hybrid polypeptides with a non-naturally occurring amino acid sequence containing insertions, deletions or substitutions of amino acids. For example, single-chain manipulating immunoglobulins may be useful in certain immunocompromised patients. Other types of non-naturally occurring gene sequences include antisense molecules and catalytic nucleic acids, such as ribozymes, which can be used to reduce the overexpression of a target.
    [111] The reduction and / or modulation of gene expression is particularly desirable for the treatment of hyperproliferative conditions characterized by hyperproliferative cells, as well as cancers and psoriasis. Target polypeptides include those polypeptides that are
    Petition 870190107951, of 10/24/2019, p. 81/188
    54/144 produced exclusively or at higher levels in hyperproliferative cells compared to normal cells. Target antigens include polypeptides encoded by oncogenes such as myb, myc, fyn and the bcr / abl translocation gene, ras, src, P53, neu, trk and EGRF. In addition to oncogene products such as target antigens, target polypeptides for cancer treatments and protection regimes include variable regions of antibodies made by B cell lymphomas and variable regions of T cell receptors of T cell lymphomas that, in some modalities, target antigens are also used for autoimmune disease. Other tumor-associated polypeptides can be used as target polypeptides, such as polypeptides that are found at higher levels in tumor cells, including the polypeptide recognized by monoclonal antibody 17-1A and folate-binding polypeptides.
    [112] Other suitable therapeutic polypeptides and proteins include those that may be useful for the treatment of individuals suffering from autoimmune diseases and disorders, conferring a broad-based protective immune response against targets that are associated with autoimmunity, including cellular receptors and cells that produce self-directed antibodies. T cell-mediated autoimmune diseases include rheumatoid arthritis (RA), multiple sclerosis (MS), Sjogren's syndrome, sarcoidosis, insulin dependent diabetes mellitus (IDDM), autoimmune thyroiditis, reactive arthritis, ankylosing spondylitis, scleroderma, polymyositis, dermatomyositis , psoriasis, vasculitis, Wegener's granulomatosis, Crohn's disease and ulcerative oolitis. Each of these diseases is characterized by T cell receptors (TCRs) that bind endogenous antigens and initiate the inflammatory cascade associated with autoimmune diseases.
    [113] Other illustrative genes that can be delivered via rAAV include, without limitation, glucose-6-phosphatase, associated with disease or deficiency
    Petition 870190107951, of 10/24/2019, p. 82/188
    55/144 storage of glycogen type 1A (GSD1), phosphoenolpyruvate carboxykinase (PEPCK), associated with PEPCK deficiency; cyclin-dependent type 5 kinase (CDKL5), also known as serine / threonine kinase 9 (STK9) associated with seizures and severe impairment of neurological development; uridyl transferase of galactose-1 phosphate, associated with galactosemia; phenylalanine hydroxylase, associated with phenylketonuria (PKU); branched-chain alpha-keto acid dehydrogenase, associated with maple syrup urine disease; fumarolacetoacetate hydrolase, associated with type 1 tyrosinemia; methylmalonyl-CoA mutase, associated with methylmalonic acidemia; medium chain acyl CoA dehydrogenase, associated with medium chain acetyl CoA deficiency; ornithine transcarbamylase (OTC), associated with ornithine transcarbamylase deficiency; argininosuccinic acid synthase (ASS1), associated with citrullinemia; lecithin-cholesterol acyltransferase (LCAT) deficiency; a methylmalonic acidemia (MMA); Niemann-Pick disease, type C1); propionic acidemia (PA); low density lipoprotein receptor (LDLR) protein, associated with familial hypercholesterolemia (HF); UDPglucouronosyltransferase, associated with Crigler-Najjar disease; adenosine deaminase, associated with severe combined immunodeficiency disease; hypoxanthine guanine phosphoribosyl transferase, associated with Gout and Lesch-Nyhan syndrome; biotimidase, associated with biotimidase deficiency; alpha-galactosidase A (a-Gal A) associated with Fabry disease); ATP7B associated with Wilson's disease; beta-glucocerebrosidase, associated with Gaucher disease types 2 and 3; 70 kDa peroxisomal membrane protein associated with Zellweger syndrome; arylsulfatase A (ARSA) associated with metachromatic leukodystrophy, enzyme galactocerebrosidase (GALC) associated with Krabbe's disease, alpha-glucosidase (GAA) associated with Pompe's disease; sphingomyelinase gene (SMPD1) associated with Niemann Pick disease type A; argininosuccinate synthase associated with adult onset type II citrullinemia (CTLN2);
    Petition 870190107951, of 10/24/2019, p. 83/188
    56/144 carbamoyl phosphate synthase 1 (CPS1) associated with disorders of the urea cycle; motor neuron survival protein (NMS), associated with spinal muscular atrophy; ceramidase associated with Farber's lipogranulomatosis; b-hexosaminidase associated with GM2 gangliosidosis and Tay-Sachs and Sandhoff diseases; aspartyl glucosaminidase associated with aspartyl glucosaminuria; a-fucosidase associated with fucosidosis; α-mannosidase associated with alpha-mannosidosis; porphobilinogen deaminase, associated with acute intermittent porphyria (PIA); alpha-1 antitrypsin for the treatment of alpha-1 antitrypsin deficiency (emphysema); erythropoietin for the treatment of anemia due to thalassemia or renal failure; vascular endothelial growth factor, angiopoietin-1, and fibroblast growth factor for the treatment of ischemic diseases; thrombomodulin and tissue factor pathway inhibitor for the treatment of occluded blood vessels, as seen, for example, in atherosclerosis, thrombosis or embolisms; aromatic amino acid decarboxylase (AADC) and tyrosine hydroxylase (TH) for the treatment of Parkinson's disease; the beta adrenergic receptor, antisense or a mutant form of phospholamban, adenosine triphosphatase-2 from the plasma sarco (endo) reticulum (SERCA2), and cardiac adenylyl cyclase for the treatment of congestive heart failure; a tumor suppressor gene such as p53 for the treatment of various cancers; a cytokine such as one of several interleukins for the treatment of inflammatory and immunological disorders and cancers; dystrophin or minidistrophine and utrophin or miniutrophin for the treatment of muscular dystrophies; and insulin or GLP-1 for the treatment of diabetes.
    [114] Additional genes and diseases of interest include, for example, diseases related to the dystonin gene, such as Hereditary Sensory and Autonomic Neuropathy Type VI (the DST gene encodes dystonin; two AAV vectors may be required due to the size of the protein (~ 7570 aa), SCN9A-related diseases, in which mutants of
    Petition 870190107951, of 10/24/2019, p. 84/188
    57/144 loss of function causes inability to feel pain and mutants of function gain cause pain conditions, such as erythromelagia. Another condition is Charcot-Marie-Tooth type 1F and 2E due to mutations in the NEFL gene (neurofilament light chain) characterized by progressive and sensory peripheral motor neuropathy with variable clinical and electrophysiological expression.
    [115] In certain embodiments, the rAAV described here can be used to treat disorders of mucopolysaccharidosis (MPS). This rAAV may contain a nucleic acid sequence encoding a-L-iduronidase (IDUA) for the treatment of MPS I (Hurler, HurlerScheie and Scheie syndromes); a nucleic acid sequence encoding iduronate-2-sulfatase (IDS) for the treatment of MPS II (Hunter syndrome); a sulfamidase-encoding nucleic acid sequence (SGSH) for the treatment of MPSIII A, B, C and D (Sanfilippo syndrome); a nucleic acid sequence encoding N-acetylgalactosamine-6-sulfate sulfatase (GALNS) for the treatment of MPS IV A and B (Morquio's syndrome); a nucleic acid sequence encoding arylsulfatase B (ARSB) for the treatment of MPS VI (MaroteauxLamy syndrome); a nucleic acid sequence encoding hyaluronidase for treatment of MPSI IX (hyaluronidase deficiency) and a nucleic acid sequence encoding beta-glucuronidase for treatment of MPS VII (Sly syndrome).
    Immunogenic transgenes [116] In some embodiments, an rAAV vector comprising a nucleic acid that encodes a cancer-associated gene product (for example, tumor suppressors) can be used to treat cancer by administering an rAAV harboring the rAAV vector to a subject with cancer. In some embodiments, an rAAV vector comprising a nucleic acid that encodes a small interfering nucleic acid (for example, shRNAs, miRNAs) that inhibits the expression of a product
    Petition 870190107951, of 10/24/2019, p. 85/188
    58/144 cancer-associated genetic (eg, oncogenes) can be used to treat cancer by administering an rAAV harboring the rAAV vector to a subject with cancer. In some embodiments, an rAAV vector comprising a nucleic acid that encodes a cancer-associated gene product (or a functional RNA that inhibits the expression of a cancer-associated gene) can be used for research purposes, for example, to study cancer or identify therapies that treat cancer. The following is a non-limiting list of exemplary genes that are associated with the development of cancer (for example, oncogenes and tumor suppressors): AARS, ABCB1, ABCC4, ABI2, ABL1, ABL2, ACK1, ACP2, ACY1, ADSL, AK1, AKR1C2, AKT1, ALB, ANPEP, ANXA5, ANXA7, AP2M1, APC, ARHGAP5, ARHGEF5, ARID4A, ASNS, ATF4, ATM, ATP5B, ATP5O, AXL, BARD1, BAX, BCL2, BHLHB2, BRM BRCA2, BTK, CANX, CAP1, CAPN1, CAPNS1, CAV1, CBFB, CBLB, CCL2, CCND1, CCND2, CCND3, CCNE1, CCT5, CCYR61, CD24, CD44, CD59, CDC20, CDC25, CDC25A, CDC25B, CDC2L5, CD10 CDK4, CDK5, CDK9, CDKL1, CDKN1A, CDKN1B, CDKN1C, CDKN2A, CDKN2B, CDKN2D, CEBPG, CENPC1, CGRRF1, CHAF1A, CIB1, CKMT1, CLK1, CLK2, CLA, COLK, CLNS CRAT, CRHR1, CSF1R, CSK, CSNK1G2, CTNNA1, CTNNB1, CTPS, CTSC, CTSD, CUL1, CYR61, DCC, DCN, DDX10, DEK, DHCR7, DHRS2, DHX8, DLG3, DVL1, DVL3, E2F2 EGFR, EGR1, EIF5, EPHA2, ERBB2, ERBB3, ERBB4, ERCC3, ETV1, ETV3, ETV6, F2R, FASTK, FBN1, FBN2, FE S, FGFR1, FGR, FKBP8, FN1, FOS, FOSL1, FOSL2, FOXG1A, FOXO1A, FRAP1, FRZB, FTL, FZD2, FZD5, FZD9, G22P1, GAS6, GCN5L2, GDF15, GNA, GN1, GNA GRB2, GSK3A, GSPT1, GTF2I, HDAC1, HDGF, HMMR, HPRT1, HRB, HSPA4, HSPA5, HSPA8, HSPB1, HSPH1, HYAL1, HYOU1, ICAM1, ID1, ID2, IDUA, IER3, IFITM1, IGFR, IGFR, IGFR, IGFR, IGFR, IGFR, IGFR
    Petition 870190107951, of 10/24/2019, p. 86/188
    59/144
    IGFBP4, IGFBP5, IL1B, ILK, ING1, IRF3, ITGA3, ITGA6, ITGB4, JAK1, JARID1A, JUN, JUNB, JUND, K-ALPHA-1, KIT, KITLG, KLK10, KPNA2, KRAS2, KRT18, KRT2A, KRT9, LAMB1, LAMP2, LCK, LCN2, LEP, LlTAF, LRPAP1, LTF, LYN, LZTR1, MADH1, MAP2K2, MAP3K8, MAPK12, MAPK13, MAPKAPK3, MAPRE1, MARS, MAS1, MCG, MCM2, MCM4, MDM2, MDM4, MGST1, MICB, MLLT3, MME, MMP1, MMP14, MMP17, MMP2, MNDA, MSH2, MSH6, MT3, MYB, MYBL1, MYBL2, MYC, MYCL1, MYCN, MYD88, MYL9, MYLK, NE01, NF1, NF2, NFKB1, NFKB2, NFSF7, NID, NINE, NMBR, NME1, NME2, NME3, N0TCH1, N0TCH2, N0TCH4, NPM1, NQ01, NR1D1, NR2F1, NR2F6, NRAS, NRG1, NSEP1, OSM, PA2G4, PCTK2 PCTK3, PDGFA, PDGFB, PDGFRA, PDPK1, PEA15, PFDN4, PFDN5, PGAM1, PHB, PIK3CA, PIK3CB, PIK3CG, PIM1, PKM2, PKMYT1, PLK2, PPARD, PPARG, PPIH, PPD2, PRPP2 PRKCBP1, PRNP, PRSS15, PSMA1, PTCH, PTEN, PTGS1, PTMA, PTN, PTPRN, RAB5A, RAC1, RAD50, RAF1, RALBP1, RAP1A, RARA, RARB, RASGRF1, RB1, RBBP4, RELB, REA, RELA RELB, RET, RFC2, RG S19, RHOA, RHOB, RHOC, RHOD, RIPK1, RPN2, RPS6 KB1, RRM1, SARS, SELENBP1, SEMA3C, SEMA4D, SEPP1, SERPINH1, SFN, SFPQ, SFRS7, SHB, SHH, SIAH2, SIVA, SIVA TP53 SKIL, SLC16A1, SLC1A4, SLC20A1, SMO, sphingomyelin phosphodiesterase 1 (SMPD1), SNAI2, SND1, SNRPB2, SOCS1, SOCS3, SOD1, SORT1, SPINT2, SPRY2, SRC, SRPX, STAT1, STAT, STAT1, STAT , TBL3, TBRG4, TCF1, TCF7L2, TFAP2C, TFDP1, TFDP2, TGFA, TGFB1, TGFBI, TGFBR2, TGFBR3, THBS1, TIE, TIMP1, TIMP3, TJP1, TK1, TLE1, TNF, TNFRSF10A, TNFRSF10A, TNFRSF10A, TNFRSF10 , TNFSF7, TNK1, TOB1, TP53, TP53BP2, TP5313, TP73, TPBG, TPT1, TRADD, TRAM1, TRRAP, TSG101, TUFM, TXNRD1, TYRO3, UBC, UBE2L6, UCHL1, USP7, VDAC1, VEG, , WNT1,
    Petition 870190107951, of 10/24/2019, p. 87/188
    60/144
    WNT2, WNT2B, WNT3, WNT5A, WT1, XRCC1, YES1, YWHAB, YWHAZ, ZAP70, and ZNF9.
    [117] An rAAV vector can comprise a transgene, a nucleic acid that encodes a functional protein or RNA that modulates apoptosis. The following is a non-limiting list of genes associated with apoptosis and nucleic acids that encode the products of these genes and their counterparts and that encode small interfering nucleic acids (for example, shRNAs, miRNAs) that inhibit the expression of these genes and their counterparts are useful as transgenes in certain embodiments of the invention: RPS27A, ABL1, AKT1, APAF1, BAD, BAG1, BAG3, BAG4, BAK1, BAX, BCL10, BCL2, BCL2A1, BCL2L1, BCL2L10, BCL2L11, BCL2L12, BCL2L13, BFAR, BID, BIK, NAIP, BIRC2, BIRC3, XIAP, BIRC5, BIRC6, BIRC7, BIRC8, BNIP1, BNIP2, BNIP3, BNIP3L, BOK, BRAF, CARD10, CARD11, NLRC4, CARD14, NOD2, NOD2, CARD14, NOD2, NOD2 CARDS, CASP1, CASP10, CASP14, CASP2, CASP3, CASP4, CASP5, CASP6, CASP7, CASP8, CASP9, CFLAR, CIDEA, CIDEB, CRADD, DAPK1, DAPK2, DFFA, DFFB, FADD, GADD45A, GDNFR, HRK, IGDN1 LTA, LTBR, MCL1, NOL3, PYCARD, RIPK1, RIPK2, TNF, TNFRSF10A, TNFRSF10B, TNFRSF10C, TNFRSF10D, TNFRSF11B, TNFRSF12A, TNFRSF14, TNFRSF19, TNFRSF1A, TNFRSF1A, TNFRSF1A, TNFRSF1A, TNFRSF1A 1, TNFRSF25, CD40, FAS, TNFRSF6B, CD27, TNFRSF9, TNFSF10, TNFSF14, TNFSF18, CD40LG, FASLG, CD70, TNFSF8, TNFSF9, TP53, TP53BP2, TP73, TP63, TRADD, TRAF1, TRAF2, TRAF2, TRAF2, TRAF2, TRAF2, TRAF2 .
    [118] Useful gene products also include miRNAs. MiRNAs and other small interfering nucleic acids regulate gene expression through cleavage / degradation of the target RNA transcript or translational repression of the target messenger RNA (mRNA). MiRNAs are expressed natively, typically as end products of
    Petition 870190107951, of 10/24/2019, p. 88/188
    61/144
    Untranslated RNAs from 19 to 25. MiRNAs exhibit their activity through specific sequence interactions with the 3 'untranslated regions (RTU) of the target mRNAs. These endogenously expressed miRNAs form hairpin precursors that are subsequently processed into a miRNA duplex and later into a mature single-stranded miRNA molecule. This mature miRNA guides a multiprotein complex, miRISC, which identifies the target site, for example, in the 3 'regions of RTU, of the target mRNAs based on their complementarity with the mature miRNA.
    [119] The following non-limiting list of miRNA genes and their counterparts are useful as genes or as targets for small interfering nucleic acids encoded by genes (for example, miRNA sponges, antisense oligonucleotides, TuD RNAs) in certain method modalities: hsa-let-7a, hsa-let-7a *, hsa-let-7b, hsa-let-7b *, hsalet-7c, hsa-let-7c *, hsa-let-7d, hsa-let-7d *, hsa-let-7e, hsa-let-7e *, hsalet-7f, hsa-let-7f-1 *, hsa-let-7f-2 *, hsa-let-7g, hsa-let-7g *, hsa- let-71, hsa-let-71 *, hsa-miR-1, hsa-miR-100, hsa-miR-100 *, hsa-miR-101, hsamiR-101 *, hsa-miR-103, hsa-miR -105, hsa-miR-105 *, hsa-miR-106a, hsa-miR-106a *, hsa-miR-106b, hsa-miR-106b *, hsa-miR-107, hsa-miR10a, hsa-miR- 10a *, hsa-miR-10b, hsa-miR-10b *, hsa-miR-1178, hsamiR-1179, hsa-miR-1180, hsa-miR-1181, hsa-miR-1182, hsa-miR1183, hsa- miR-1184, hsa-miR-1185, hsa-miR-1197, hsa-miR-1200, hsa-miR-1201, hsa-miR-1202, hsa-miR-1203, hsa-miR-1204, hsa-miR1205, hsa-miR-1206, hsa-miR-1207-3p, hsa-miR-1207-5p, hsa-miR1208, hsa-mi R-122, hsa-miR-122 *, hsa-miR-1224-3p, hsa-miR-12245p, hsa-miR-1225-3p, hsa-miR-1225-5p, hsa-miR-1226, hsa-miR1226 *, hsa-miR-1227, hsa-miR-1228, hsa-miR-1228 *, hsa-miR-1229, hsa-miR-1231, hsa-miR-1233, hsa-miR-1234, hsa-miR-1236 , hsa-miR1237, hsa-miR-1238, hsa-miR-124, hsa-miR-124 *, hsa-miR-1243, hsamiR-1244, hsa-miR-1245, hsa-miR-1246, hsa-miR- 1247, hsa-miR
    Petition 870190107951, of 10/24/2019, p. 89/188
    62/144
    1248, hsa-miR-1249, hsa-miR-1250, hsa-miR-1251, hsa-miR-1252, hsa-miR-1253, hsa-miR-1254, hsa-miR-1255a, hsa-miR-1255b, hsamiR-1256, hsa-miR-1257, hsa-miR-1258, hsa-miR-1259, hsa-miR125a-3p, hsa-miR-125a-5p, hsa-miR-125b, hsa-miR-125b-1 * , hsa-miR125b-2 *, hsa-miR-126, hsa-miR-126 *, hsa-miR-1260, hsa-miR-1261, hsa-miR-1262, hsa-miR-1263, hsa-miR-1264 , hsa-miR-1265, hsa-miR1266, hsa-miR-1267, hsa-miR-1268, hsa-miR-1269, hsa-miR-1270, hsa-miR-1271, hsa-miR-1272, hsa-miR -1273, hsa-miR-127-3p, hsamiR-1274a, hsa-miR-1274b, hsa-miR-1275, hsa-miR-127-5p, hsa-miR1276, hsa-miR-1277, hsa-miR-1278 , hsa-miR-1279, hsa-miR-128, hsamiR-1280, hsa-miR-1281, hsa-miR-1282, hsa-miR-1283, hsa-miR1284, hsa-miR-1285, hsa-miR-1286 , hsa-miR-1287, hsa-miR-1288, hsa-miR-1289, hsa-miR-129 *, hsa-miR-1290, hsa-miR-1291, hsa-miR1292, hsa-miR-1293, hsa- miR-129-3p, hsa-miR-1294, hsa-miR-1295, hsa-miR-129-5p, hsa-miR-1296, hsa-miR-1297, hsa-miR-1298, hsamiR-1299, hsa- miR-1300, hsa-miR-1301, hsa-miR-1302, hsa-miR1303, hsa -miR-1304, hsa-miR-1305, hsa-miR-1306, hsa-miR-1307, hsa-miR-1308, hsa-miR-130a, hsa-miR-130a *, hsa-miR-130b, hsa- miR130b *, hsa-miR-132, hsa-miR-132 *, hsa-miR-1321, hsa-miR-1322, hsamiR-1323, hsa-miR-1324, hsa-miR-133a, hsa-miR-133b, hsa-miR-134, hsa-miR-135a, hsa-miR-135a *, hsa-miR-135b, hsa-miR-135b *, hsamiR-136, hsa-miR-136 *, hsa-miR-137, hsa -miR-138, hsa-miR-138-Γ, hsa-miR-138-2 *, hsa-miR-139-3p, hsa-miR-139-5p, hsa-miR-140-3p, hsa-miR- 140-5p, hsa-miR-141, hsa-miR-141 *, hsa-miR-142-3p, hsamiR-142-5p, hsa-miR-143, hsa-miR-143 *, hsa-miR-144, hsa-miR-144 *, hsa-miR-145 *, hsa-miR-145 *, hsa-miR-146a, hsa-miR-146a *, hsa-miR146b-3p, hsa-miR-146b-5p, hsa-miR -147, hsa-miR-147b, hsa-miR148a, hsa-miR-148a *, hsa-miR-148b, hsa-miR-148b *, hsa-miR-149, hsa-miR-149 *, hsa-miR- 150, hsa-miR-150 *, hsa-miR-151-3p, hsa-miR151-5p, hsa-miR-152, hsa-miR-153, hsa-miR-154, hsa-miR-154 *, hsa
    Petition 870190107951, of 10/24/2019, p. 90/188
    63/144 miR-155, hsa-miR-155 *, hsa-miR-15a, hsa-miR-15a *, hsa-miR-15b, hsa-miR-15b *, hsa-miR-16, hsa-miR- 16-Γ, hsa-miR-16-2 *, hsa-miR-17, hsa-miR-17 *, hsa-miR-181a, hsa-miR-181a *, hsa-miR-181a-2 *, hsamiR- 181b, hsa-miR-181c, hsa-miR-181c *, hsa-miR-181d, hsa-miR-182, hsa-miR-182 *, hsa-miR-1825, hsa-miR-1826, hsa-miR- 1827, hsa-miR183, hsa-miR-183 *, hsa-miR-184, hsa-miR-185, hsa-miR-185 *, hsamiR-186, hsa-miR-186 *, hsa-miR-187, hsa -miR-187 *, hsa-miR-188-3p, hsa-miR-188-5p, hsa-miR-18a, hsa-miR-18a *, hsa-miR-18b, hsa-miR18b *, hsa-miR- 190, hsa-miR-190b, hsa-miR-191, hsa-miR-191 *, hsamiR-192, hsa-miR-192 *, hsa-miR-193a-3p, hsa-miR-193a-5p, hsa- miR193b, hsa-miR-193b *, hsa-miR-194, hsa-miR-194 *, hsa-miR-195, hsamiR-195 *, hsa-miR-196a, hsa-miR-196a *, hsa-miR- 196b, hsa-miR-197, hsa-miR-198, hsa-miR-199a-3p, hsa-miR-199a-5p, hsa-miR-199b-5p, hsa-miR-19a, hsa-miR-19a * , hsa-miR-19b, hsa-miR-19b-1 *, hsa-miR19b-2 *, hsa-miR-200a, hsa-miR-200a *, hsa-miR-200b, hsa-miR-200b *, hsa -miR-200c, hsa-miR-200c *, hs a-miR-202, hsa-miR-202 *, hsa-miR203, hsa-miR-204, hsa-miR-205, hsa-miR-206, hsa-miR-208a, hsa-miR208b, hsa-miR-20a , hsa-miR-20a *, hsa-miR-20b, hsa-miR-20b *, hsamiR-21, hsa-miR-21 *, hsa-miR-210, hsa-miR-211, hsa-miR-212, hsamiR-214, hsa-miR-214 *, hsa-miR-215, hsa-miR-216a, hsa-miR-216b, hsa-miR-217, hsa-miR-218, hsa-miR-218-Γ, hsa -miR-218-2 *, hsa-miR21 9-1 -3p, hsa-miR-219-2-3p, hsa-miR-219-5p, hsa-miR-22, hsa-miR22 *, hsa-miR- 220a, hsa-miR-220b, hsa-miR-220c, hsa-miR-221, hsamiR-221 *, hsa-miR-222, hsa-miR-222 *, hsa-miR-223, hsa-miR-223 * , hsa-miR-224, hsa-miR-23a, hsa-miR-23a *, hsa-miR-23b, hsa-miR-23b *, hsa-miR-24, hsa-miR-24-Γ, hsa-miR -24-2 *, hsa-miR-25, hsa-miR-25 *, hsa-miR-26a, hsa-miR-26a-1 *, hsa-miR-26a-2 *, hsa-miR-26b, hsa -miR26b *, hsa-miR-27a, hsa-miR-27a *, hsa-miR-27b, hsa-miR-27b *, hsamiR-28-3p, hsa-miR-28-5p, hsa-miR-296- 3p, hsa-miR-296-5p, hsa-miR297, hsa-miR-298, hsa-miR-299-3p, hsa-miR-299-5p, hsa-miR-29a,
    Petition 870190107951, of 10/24/2019, p. 91/188
    64/144 hsa-miR-29a *, hsa-miR-29b, hsa-miR-296-Γ, hsa-miR-296-2 *, hsamiR-29c, hsa-miR-29c *, hsa-miR-300, hsa-miR-301a, hsa-miR-301b, hsa-miR-302a, hsa-miR-302a *, hsa-miR-302b, hsa-miR-302b *, hsamiR-302c, hsa-miR-302c *, hsa -miR-302d, hsa-miR-302d *, hsa-miR302e, hsa-miR-302f, hsa-miR-30a, hsa-miR-30a *, hsa-miR-30b, hsamiR-30b *, hsa-miR- 30c, hsa-miR-30c-1 *, hsa-miR-30c-2 *, hsa-miR30d, hsa-miR-30d *, hsa-miR-30e, hsa-miR-30e *, hsa-miR-31, hsa-miR3Γ, hsa-miR-32, hsa-miR-32 *, hsa-miR-320a, hsa-miR-320b, hsa-miR320c, hsa-miR-320d, hsa-miR-323-3p, hsa-miR -323-5p, hsa-miR-3243p, hsa-miR-324-5p, hsa-miR-325, hsa-miR-326, hsa-miR-328, hsamiR-329, hsa-miR-330-3p, hsa -miR-330-5p, hsa-miR-331-3p, hsa-miR331-5p, hsa-miR-335, hsa-miR-335 *, hsa-miR-337-3p, hsa-miR-337-5p, hsa-miR-338-3p, hsa-miR-338-5p, hsa-miR-339-3p, hsa-miR-339-5p, hsa-miR-33a, hsa-miR-33a *, hsa-miR-33b , hsa-miR-33b *, hsa-miR-340, hsa-miR-340 *, hsa-miR-342-3p, hsa-miR-342-5p, hsa-miR-345, hsamiR-346, hsa-miR -34a, hsa-miR-34a *, hsa-miR -34b, hsa-miR-34b *, hsa-miR-34c-3p, hsa-miR-34c-5p, hsa-miR-361-3p, hsa-miR-361-5p, hsa-miR-362-3p, hsa-miR-362-5p, hsa-miR-363, hsa-miR-363 *, hsamiR-365, hsa-miR-367, hsa-miR-367 *, hsa-miR-369-3p, hsa-miR- 3695p, hsa-miR-370, hsa-miR-371-3p, hsa-miR-371-5p, hsa-miR-372, hsamiR-373, hsa-miR-373 *, hsa-miR-374a, hsa-miR -374a *, hsa-miR-374b, hsa-miR-374b *, hsa-miR-375, hsa-miR-376a, hsa-miR-376a *, hsa-miR376b, hsa-miR-376c, hsa-miR- 377, hsa-miR-377 *, hsa-miR-378, hsamiR-378 *, hsa-miR-379, hsa-miR-379 *, hsa-miR-380, hsa-miR-380 *, hsa-miR- 381, hsa-miR-382, hsa-miR-383, hsa-miR-384, hsa-miR-4093p, hsa-miR-409-5p, hsa-miR-410, hsa-miR-411, hsa-miR- 4H *, hsamiR-412, hsa-miR-421, hsa-miR-422a, hsa-miR-423-3p, hsa-miR-4235p, hsa-miR-424, hsa-miR-424 *, hsa-miR- 425, hsa-miR-425 *, hsa-miR429, hsa-miR-431, hsa-miR-43r, hsa-miR-432, hsa-miR-432 *, hsamiR-433, hsa-miR-448, hsa- miR-449a, hsa-miR-449b, hsa-miR-450a,
    Petition 870190107951, of 10/24/2019, p. 92/188
    65/144 hsa-miR-450b-3p, hsa-miR-450b-5p, hsa-miR-451, hsa-miR-452, hsamiR-452 *, hsa-miR-453, hsa-miR-454, hsa- miR-454 *, hsa-miR-455-3p, hsa-miR-455-5p, hsa-miR-483-3p, hsa-miR-483-5p, hsa-miR-484, hsamiR-485-3p, hsa -miR-485-5p, hsa-miR-486-3p, hsa-miR-486-5p, hsamiR-487a, hsa-miR-487b, hsa-miR-488, hsa-miR-488 *, hsa-miR- 489, hsa-miR-490-3p, hsa-miR-490-5p, hsa-miR-491-3p, hsa-miR-491-5p, hsa-miR-492, hsa-miR-493, hsa-miR- 493 *, hsa-miR-494, hsa-miR-495, hsa-miR-496, hsa-miR-497, hsa-miR-497 *, hsa-miR-498, hsa-miR-4993p, hsa-miR- 499-5p, hsa-miR-500, hsa-miR-500 *, hsa-miR-501-3p, hsa-miR-501-5p, hsa-miR-502-3p, hsa-miR-502-5p, hsa -miR-503, hsamiR-504, hsa-miR-505, hsa-miR-505 *, hsa-miR-506, hsa-miR-507, hsamiR-508-3p, hsa-miR-508-5p, hsa- miR-509-3-5p, hsa-miR-509-3p, hsamiR-509-5p, hsa-miR-510, hsa-miR-511, hsa-miR-512-3p, hsa-miR512-5p, hsa- miR-513a-3p, hsa-miR-513a-5p, hsa-miR-513b, hsa-miR513c, hsa-miR-514, hsa-miR-515-3p, hsa-miR-515-5p, hsa-miR- 516a3p, hsa-miR-516a-5p, hsa-miR-516b, hsa-miR-517 *, hsa-miR-517a, hsa-miR-517b, hsa-miR-517c, hsa-miR-518a-3p, hsa-miR-518a-5p, hsa-miR-518b, hsa-miR -518c, hsa-miR-518c *, hsa-miR-518d-3p, hsamiR-518d-5p, hsa-miR-518e, hsa-miR-518e *, hsa-miR-518f, hsa-miR518f *, hsa- miR-519a, hsa-miR-519b-3p, hsa-miR-519c-3p, hsa-miR519d, hsa-miR-519e, hsa-miR-519e *, hsa-miR-520a-3p, hsa-miR-520a5p , hsa-miR-520b, hsa-miR-520c-3p, hsa-miR-520d-3p, hsa-miR-520d5p, hsa-miR-520e, hsa-miR-520f, hsa-miR-520g, hsa-miR -520h, hsamiR-521, hsa-miR-522, hsa-miR-523, hsa-miR-524-3p, hsa-miR-5245p, hsa-miR-525-3p, hsa-miR-525-5p, hsa -miR-526b, hsa-miR-526b *, hsa-miR-532-3p, hsa-miR-532-5p, hsa-miR-539, hsa-miR-541, hsamiR-541 *, hsa-miR-542 -3p, hsa-miR-542-5p, hsa-miR-543, hsa-miR544, hsa-miR-545, hsa-miR-545 *, hsa-miR-548a-3p, hsa-miR-548a-5p, hsa-miR-548b-3p, hsa-miR-5486-5p, hsa-miR-548c-3p, hsa-miR-548c5p, hsa-miR-548d-3p, hsa-miR-548d-5p, hsa-miR- 548e, hsa-miR-548f,
    Petition 870190107951, of 10/24/2019, p. 93/188
    66/144 hsa-miR-548g, hsa-miR-548h, hsa-miR-548i, hsa-miR-548j, hsa-miR548k, hsa-miR-5481, hsa-miR-548m, hsa-miR-548n, hsa -miR-548o, hsa-miR-548p, hsa-miR-549, hsa-miR-550, hsa-miR-550 *, hsa-miR551a, hsa-miR-551b, hsa-miR-551 b *, hsa- miR-552, hsa-miR-553, hsamiR-554, hsa-miR-555, hsa-miR-556-3p, hsa-miR-556-5p, hsa-miR557, hsa-miR-558, hsa-miR- 559, hsa-miR-561, hsa-miR-562, hsa-miR563, hsa-miR-564, hsa-miR-566, hsa-miR-567, hsa-miR-568, hsa-miR569, hsa-miR- 570, hsa-miR-571, hsa-miR-572, hsa-miR-573, hsa-miR574-3p, hsa-miR-574-5p, hsa-miR-575, hsa-miR-576-3p, hsa- miR-5765p, hsa-miR-577, hsa-miR-578, hsa-miR-579, hsa-miR-580, hsa-miR581, hsa-miR-582-3p, hsa-miR-582-5p, hsa- miR-583, hsa-miR-584, hsa-miR-585, hsa-miR-586, hsa-miR-587, hsa-miR-588, hsa-miR-589, hsa-miR-589 *, hsa-miR -590-3p, hsa-miR-590-5p, hsa-miR-591, hsamiR-592, hsa-miR-593, hsa-miR-593 *, hsa-miR-595, hsa-miR-596, hsamiR- 597, hsa-miR-598, hsa-miR-599, hsa-miR-600, hsa-miR-601, hsamiR-602, hsa-miR-603, hsa-miR-604, hsa-miR- 605, hsa-miR-606, hsamiR-607, hsa-miR-608, hsa-miR-609, hsa-miR-610, hsa-miR-611, hsamiR-612, hsa-miR-613, hsa-miR- 614, hsa-miR-615-3p, hsa-miR-6155p, hsa-miR-616, hsa-miR-616 *, hsa-miR-617, hsa-miR-618, hsa-miR619, hsa-miR-620 , hsa-miR-621, hsa-miR-622, hsa-miR-623, hsa-miR624, hsa-miR-624 *, hsa-miR-625, hsa-miR-625 *, hsa-miR-626, hsamiR -627, hsa-miR-628-3p, hsa-miR-628-5p, hsa-miR-629, hsa-miR629 *, hsa-miR-630, hsa-miR-631, hsa-miR-632, hsa- miR-633, hsa-miR634, hsa-miR-635, hsa-miR-636, hsa-miR-637, hsa-miR-638, hsa-miR639, hsa-miR-640, hsa-miR-641, hsa- miR-642, hsa-miR-643, hsa-miR644, hsa-miR-645, hsa-miR-646, hsa-miR-647, hsa-miR-648, hsa-miR649, hsa-miR-650, hsa- miR-651, hsa-miR-652, hsa-miR-653, hsa-miR654-3p, hsa-miR-654-5p, hsa-miR-655, hsa-miR-656, hsa-miR-657, hsa- miR-658, hsa-miR-659, hsa-miR-660, hsa-miR-661, hsa-miR-662, hsa-miR-663, hsa-miR-663b, hsa-miR-664, hsa-miR- 664 *, hsa-miR
    Petition 870190107951, of 10/24/2019, p. 94/188
    67/144
    665, hsa-miR-668, hsa-miR-671-3p, hsa-miR-671-5p, hsa-miR-675, hsa-miR-7, hsa-miR-708, hsa-miR-708 *, hsa -miR-7-1 *, hsa-miR-7-2 *, hsa-miR-720, hsa-miR-744, hsa-miR-744 *, hsa-miR-758, hsa-miR-760, hsa- miR-765, hsa-miR-766, hsa-miR-767-3p, hsa-miR-767-5p, hsamiR-768-3p, hsa-miR-768-5p, hsa-miR-769-3p, hsa- miR-769-5p, hsamiR-770-5p, hsa-miR-802, hsa-miR-873, hsa-miR-874, hsa-miR-8753p, hsa-miR-875-5p, hsa-miR-876- 3p, hsa-miR-876-5p, hsa-miR-877, hsa-miR-877 *, hsa-miR-885-3p, hsa-miR-885-5p, hsa-miR-886-3p, hsamiR-886 -5p, hsa-miR-887, hsa-miR-888, hsa-miR-888 *, hsa-miR-889, hsa-miR-890, hsa-miR-891a, hsa-miR-891b, hsa-miR- 892a, hsa-miR892b, hsa-miR-9, hsa-miR-9 *, hsa-miR-920, hsa-miR-921, hsa-miR922, hsa-miR-923, hsa-miR-924, hsa-miR -92a, hsa-miR-92a-1 *, hsamiR-92a-2 *, hsa-miR-92b, hsa-miR-92b *, hsa-miR-93, hsa-miR-93 *, hsa-miR-933 , hsa-miR-934, hsa-miR-935, hsa-miR-936, hsa-miR-937, hsa-miR-938, hsa-miR-939, hsa-miR-940, hsa-miR-941, hsa -miR-942, hsa-miR-943, hsa-miR-944, hsa-miR-95, hsa-m iR-96, hsa-miR-96 *, hsa-miR-98, hsa-miR-99a, hsa-miR-99a *, hsa-miR-99b, and hsa-miR99b *. For example, miRNA directed to the open reading frame 72 of chromosome 8 (C9orf72) that expresses superoxide dismutase (SOD1), associated with amyotrophic lateral sclerosis (ALS) may be of interest.
    [120] A miRNA inhibits the function of the target mRNAs and, as a result, inhibits the expression of the polypeptides encoded by the mRNAs. Thus, blocking (partial or total) miRNA activity (for example, silencing miRNA) can effectively induce or restore the expression of a polypeptide whose expression is inhibited (express the polypeptide). In one embodiment, derepression of polypeptides encoded by a miRNA mRNA targets is accomplished by inhibiting miRNA activity in cells by any of a variety of methods. For example, blocking miRNA activity can
    Petition 870190107951, of 10/24/2019, p. 95/188
    68/144 can be performed by hybridization with a small interfering nucleic acid (for example, antisense oligonucleotide, miRNA sponge, TuD RNA) that is complementary or substantially complementary to the miRNA, thus blocking the interaction of the miRNA with its target mRNA. As used herein, a small interfering nucleic acid that is substantially complementary to a miRNA is one that is able to hybridize to a miRNA and block miRNA activity. In some embodiments, a small interfering nucleic acid that is substantially complementary to a miRNA is a small interfering nucleic acid that is complementary to miRNA, except 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12,13, 14, 15, 16, 17 or 18 bases. A miRNA inhibitor is an agent that blocks miRNA function, expression and / or processing. For example, these molecules include, but are not limited to, microRNA specific antisense, microRNA sponges, difficult decoy RNAs (TuD RNAs) and microRNA oligonucleotides (double-stranded oligonucleotides, hairpin, short oligonucleotides) that inhibit miRNA interaction with a Drosha complex.
    [121] Still other useful genes may include those that encode immunoglobulins that confer passive immunity to a pathogen. An immunoglobulin molecule is a protein that contains the immunologically active portions of an immunoglobulin heavy chain and immunoglobulin light chain that are covalently coupled and capable of specifically combining with the antigen. The immunoglobulin molecules are of any type (for example, IgG, IgE, IgM, IgD, IgA and IgY), class (for example, lgG1, lgG2, lgG3, lgG4, lgA1 and lgA2) or subclass. The terms antibody and immunoglobulin can be used interchangeably in this document.
    [122] An immunoglobulin heavy chain is a polypeptide that contains at least a portion of an immunoglobulin antigen-binding domain and at least a portion of a variable region
    Petition 870190107951, of 10/24/2019, p. 96/188
    69/144 of an immunoglobulin heavy chain or at least a portion of an immunoglobulin heavy chain constant region. Thus, the immunoglobulin-derived heavy chain has significant regions of amino acid sequence homology with a member of the immunoglobulin gene superfamily. For example, the heavy chain on a Fab fragment is an immunoglobulin-derived heavy chain.
    [123] An immunoglobulin light chain is a polypeptide that contains at least a portion of the immunoglobulin antigen-binding domain and at least a portion of the variable region or at least a portion of a constant region of an immunoglobulin light chain. Thus, the immunoglobulin-derived light chain has significant regions of the amino acid sequence with a member of the immunoglobulin gene superfamily.
    [124] An immunoadhesin is an antibody-like chimeric molecule that combines the functional domain of a binding protein, usually a receptor, linker, or cell adhesion molecule, with immunoglobulin constant domains, usually including the hinge and Fc regions.
    [125] An antigen-binding fragment (Fab) is a region in an antibody that binds to antigens. It consists of a constant and variable domain of each of the heavy and light chains.
    [126] The antipathogen construct is selected based on the causative agent (pathogen) of the disease against which protection is sought. These pathogens can be of viral, bacterial or fungal origin and can be used to prevent infection in humans against human disease, or in non-human mammals or other animals to prevent veterinary disease.
    [127] rAAV may include genes that encode antibodies and, in particular, neutralizing antibodies against a viral pathogen. Such antiviral antibodies may include anti-influenza antibodies directed at
    Petition 870190107951, of 10/24/2019, p. 97/188
    70/144 against one or more of the influenza A, influenza B and influenza C viruses. Type A viruses are the most virulent human pathogens. The influenza A serotypes that have been associated with pandemics include H1N1, which caused the Spanish flu in 1918 and the swine flu in 2009; H2N2, which caused the Asian flu in 1957; H3N2, which caused the Hong Kong flu in 1968; H5N1, which caused bird flu in 2004; H7N7; H1N2; H9N2; H7N2; H7N3; and H10N7. Other target pathogenic viruses include arenavirus (including funina, machupo and Lassa), phylovirus (including Marburg and Ebola), hantavirus, picornoviridae (including rhinovirus, echovirus), coronavirus, paramixovirus, morbillivirus, respiratory syncytial virus, togavirus, coxsack virus, JC virus , parvovirus B19, parainfluenza, adenovirus, reovirus, smallpox (Variola major (Smallpox)) and Vaccinia (Cowpox) from the family of poxviruses and varicella-zoster (pseudorabisks). Viral hemorrhagic fevers are caused by members of the arenavirus (Lassa fever) family (whose family is also associated with lymphocytic choriomeningitis (LCM)), filovirus (ebola virus) and hantavirus (puremala). Members of the picornavirus (a derinovirus subfamily) are associated with the common cold in humans. The coronavirus family, which includes several non-human viruses, such as infectious bronchitis virus (poultry), porcine transmissible gastroenteric virus (pig), swine hemagglutin encephalomyelitis virus (pig), feline infectious peritonitis virus (cat), coronavirus feline enteric (cat), canine coronavirus (dog). Human respiratory coronaviruses have been associated with a common cold, hepatitis not A, B or C and sudden acute respiratory syndrome (SARS). The paramyxovirus family includes parainfluenza virus type 1, parainfluenza virus type 3, bovine parainfluenza virus type 3, rubulavirus (mumps virus, parainfluenza virus type 2, parainfluenza virus type 4, Newcastle disease virus (chickens), rinderpest, morbillivirus, which includes measles and canine distemper and pneumovirus, which includes respiratory syncytial virus (RSV).
    Petition 870190107951, of 10/24/2019, p. 98/188
    71/144 parvovirus includes feline parvovirus (feline enteritis), feline panleukopeniavirus, canine parvovirus and porcine parvovirus. The adenovirus family includes viruses (EX, AD7, ARD, O.B.) that cause respiratory diseases. Thus, in certain embodiments, an rAAV vector as described herein can be modified to express an anti-ball antibody, for example, 2G4, 4G7,13C6, an anti-influenza antibody, for example, FI6, CR8033 and anti-RSV antibody, for example , palivizumab, motavizumab.
    [128] A neutralizing antibody construct against a bacterial pathogen can also be selected for use in the present invention. In one embodiment, the neutralizing antibody construct is directed against the bacteria itself. In another embodiment, the neutralizing antibody construct is directed against a toxin produced by bacteria. Examples of airborne bacterial pathogens include, for example, Neisseria meningitidis (meningitis), Klebsiella pneumonia (pneumonia), Pseudomonas aeruginosa (pneumonia), Pseudomonas pseudomallei (pneumonia), Pseudomonas mallei (pneumonia), Acinetobacter (pneumonia), Moraxella catarrhalella Moraxella lacunata, Alkaligenes, Cardiobacterium, Haemophilus influenzae (flu), Haemophilus parainfluenzae, Bordetella pertussis (whooping cough), Francisella tularensis (pneumonia / febrr), Legionella pneumonia (Legionnaire's disease), Chlamydia psittaci (pneumonia), Chlamydia pneumonia, pneumonia Mycobacterium tuberculosis (tuberculosis (TB)), Mycobacterium kansasii (TBj, Mycobacterium avium (pneumonia), Nocardia asteroides (pneumonia), Bacillus anthracis (anthrax), Staphylococcus aureus (pneumonia), Streptococcus pyogenes (pneumococcus), pneumococcus) Corynebacteria diphtheria (diphtheria), Mycoplasma pneumoniae (pneumonia).
    [129] rAAV may include genes that encode neutralizing antibodies and antibodies particularly against a bacterial pathogen, such as the causative agent of anthrax, a toxin produced by Bacillius
    Petition 870190107951, of 10/24/2019, p. 99/188
    72/144 anthracis. Neutralizing antibodies against the protective agent (PA), one of the three peptides that form the toxoid, have been described. The other two polypeptides consist of a lethal factor (LF) and edema factor (EF). Neutralizing anti-PA antibodies have been described as being effective in passive immunization against anthrax. See, for example, US patent number 7,442,373; R. Sawada-Hirai et al., J. Immune Based Ther Vaccines. 2004; 2: 5. (May 2004.12 online). Still other antibodies neutralizing the anti-anthrax toxin have been described and / or can be generated. Likewise, neutralizing antibodies against other bacteria and / or bacterial toxins can be used to generate an anti-pathogen construct delivered by AAV, as described here.
    [130] Antibodies to infectious diseases can be caused by parasites or fungi, including, for example, species of Aspergillus, Absidia corymbifera, Rhixpus stolonifer, Mucor plumbeaus, Cryptococcus neoformans, Histoplasm capsulatum, Blastomyces dermatitidis, Coccidioillides immitis faeni, Thermoactinomyces vulgaris, Alternaria alternate, Clade sporium species, Helminthosporium and Stachybotrys.
    [131] rAAV may include genes that encode antibodies, and particularly neutralizing antibodies, against disease pathogens such as Alzheimer's disease (AD), Parkinson's disease (PD), GBA-Parkinson, rheumatoid arthritis (RA), irritable bowel (IBS), chronic obstructive pulmonary disease (COPD), cancer, tumors, systemic sclerosis, asthma and other diseases. Such antibodies can be., Without limitation, for example, alpha-synuclein, anti-vascular endothelial growth factor (VEGF) (anti-VEGF), anti-VEGFA, anti-PD-1, antiPDL1, anti-CTLA-4, anti-TNF-alpha, anti-IL-17, anti-IL-23, anti-IL-21, antiIL-6, anti-IL-6 receptor, anti-IL-5, anti-IL-7, anti-factor XII, anti-IL-2, antiHIV, anti-IgE, antitumor necrosis factor-1 (TNFR1) receptor, anti-target 2/3, anti-notch 1, anti-OX40, receptor tyrosine kinase 3
    Petition 870190107951, of 10/24/2019, p. 100/188
    73/144 anti-erb-b2 (ErbB3), anti-ErbB2, anti-cell maturation antigen, anti-B lymphocyte stimulator, anti-CD20, anti-HER2, anti-granulocyte macrophage colony stimulating factor, anthioncostatin M (OSM), anti-lymphocyte activating gene 3 protein (LAG3), antiCCL20, serum amyloid P component (SAP), antiprolyl hydroxylase inhibitor, anti-CD38, anti-CD52, anti-CD30, anti-CD30, antiIL- 1 beta, anti-epidermal growth factor receptor, anti-CD25, anti-RANK ligand, anti-complement system C5 protein, anti CD11a, anti-CD3 receptor, anti-alpha-4 (a4) integrin, anti-RSV F protein and anti- integrin cup . Still other pathogens and diseases will be evident to one skilled in the art. Other suitable antibodies may include those useful in the treatment of Alzheimer's disease, such as, for example, anti-beta-amyloid (e.g., crenezumab, solanezumab, aducanumab), anti-beta-amyloid fibril, anti-beta-amyloid plaques, anti-tau , a bapineuzamab, among others. Other antibodies suitable for the treatment of a variety of indications include those described, for example, in PCT / US2016 / 058968, deposited on October 27, 2016, published as WO 2017 / 075119A1.
    II. Vector production of rAAV [132] For use in the production of an AAV viral vector (for example, a recombinant AAV (r)), expression cassettes can be transported in any suitable vector, for example, a plasmid, which is delivered to a packaging host cell. Plasmids useful in this invention can be engineered to be suitable for replication and packaging in vitro in prokaryotic cells, insect cells, mammalian cells, among others. Suitable transfection techniques and packaging host cells are known and / or can be readily designed by one skilled in the art.
    [133] Methods for generating and isolating AAVs suitable for use
    Petition 870190107951, of 10/24/2019, p. 101/188
    74/144 as vectors are known in the art. See general, for example, Grieger & Samulski, 2005, Adeno-associated virus as a gene therapy vector: Vector development, production and clinical applications, Adv. Biochem. Engin / Biotechnol. 99: 119-145; Buning et al., 2008, Recent developments in adeno-associated virus vector technology, J. Gene Med. 10: 717-733; and the references cited below, each of which is incorporated herein by reference in its entirety. To package a gene into virions, ITRs are the only AAV components needed in cis in the same construct as the nucleic acid molecule that contains the expression cassette (s). The cap and rep genes can be supplied in trans.
    [134] In one embodiment, the expression cassettes described here are modified by genetic manipulation into a genetic element (for example, a shuttle plasmid) that transfers the immunoglobulin construct sequences transported therein to a packaging host cell for production of a viral vector. In one embodiment, the selected genetic element can be delivered to an AAV packaging cell by any suitable method, including transfection, electroporation, liposome distribution, membrane fusion techniques, high-speed DNA-coated granules, viral infection and fusion protoplasts. Stable AAV packaging cells can also be made. Alternatively, expression cassettes can be used to generate a viral vector other than AAV, or to produce antibody mixtures in vitro. The methods used to make such constructs are known to those skilled in nucleic acid manipulation and include genetic manipulation, recombinant manipulation and synthetic techniques. See, for example, Molecular Cloning: A Laboratory Manual, ed. Green and Sambrook, Cold Spring Harbor Press, Cold Spring Harbor, NY (2012).
    [135] The intermediate term AAV or intermediate term of the AAV vector
    Petition 870190107951, of 10/24/2019, p. 102/188
    75/144 refers to an assembled rAAV capsid that does not have the desired genomic sequences packaged therein. These can also be called empty capsids. This capsid may not contain any detectable genomic sequence from an expression cassette or only partially packaged genomic sequences, which are insufficient to obtain the genomic product. These empty capsids are not functional for transferring the gene of interest to a host cell.
    [136] The recombinant adenoassociated virus (AAV) described in this document can be generated using techniques that are known. See, for example, WO 2003/042397; WO 2005/033321, WO 2006/110689; US 7588772 B2. This method involves culturing a host cell that contains a nucleic acid sequence that encodes an AAV capsid protein; a rep gene. functional; an expression cassette composed of at least AAV inverted terminal repeats (ITRs) and a transgene; and sufficient auxiliary functions to allow packaging of the expression cassette into the AAV capsid protein. Methods for generating capsids, and coding sequences for them, and methods for producing rAAV viral vectors have been described. See, for example, Gao, et al, Proc. Natl. Acad. Sci. U.S.A. 100 (10), 6081-6086 (2003) and US 2013 / 0045186A1.
    [137] In one embodiment, a production cell culture useful for producing a recombinant AAVhu68 is provided. This cell culture contains a nucleic acid that expresses the AAVhu68 capsid protein in the host cell; a nucleic acid molecule suitable for packaging in the AAVhu68 capsid, for example, a vector genome containing AAV ITRs and a non-AAV nucleic acid sequence that encodes a gene product operably linked to sequences that direct product expression in a host cell; and sufficient AAV rep functions and auxiliary adenovirus functions to
    Petition 870190107951, of 10/24/2019, p. 103/188
    76/144 allow packaging of the nucleic acid molecule into the recombinant AAVhu68 capsid. In one embodiment, the cell culture is composed of mammalian cells (for example, human embryonic kidney 293 cells, among others) or insect cells (for example, baculovirus).
    [138] Optionally, the rep functions are provided by an AAV other than hu68. In certain embodiments, at least parts of the rep functions of AAVhu68. See, for example, the rep sequences encode the rep proteins of SEQ ID NO: 4 and their functional fragments. The rep AAV can be encoded by the nucleic acid sequence of SEQ ID NO: 3. In another embodiment, the rep protein is a heterologous protein other than AAVhu68rep, for example, but is not limited to the rep protein AAV1, rep protein AAV2, rep protein AAV3, rep protein AAV4, rep protein AAV5, rep protein AAV6, rep protein AAV7, rep protein AAV8; or rep 78, rep 68, rep 52, rep 40, rep68 / 78 and rep40 / 52; or a fragment thereof; or another source. Optionally, the rep and cap sequences are in the same genetic element in the cell culture. There may be a spacer between the rep sequence and the cap gene. Optionally, the spacer is atgacttaaaccaggt, SEQ ID NO: 9. Any of these sequences of the AAVhu68 or mutant AAV capsid can be under the control of exogenous regulatory control sequences that direct their expression in a host cell.
    [139] In one embodiment, cells are made in a suitable cell culture (for example, HEK 293 cells). The methods for making the gene therapy vectors described in this document include methods well known in the art, such as generation of plasmid DNA, used for the production of gene therapy vectors, generation of the vectors and purification of the vectors. In some embodiments, the gene therapy vector is an AAV vector and the generated plasmids are a cis AAV plasmid encoding the AAV genome and the
    Petition 870190107951, of 10/24/2019, p. 104/188
    77/144 gene of interest, an AAV trans plasmid containing AAV rep and cap genes and an adenovirus helper plasmid. The vector generation process may include steps in the method, such as cell culture initiation, cell passage, cell sowing, transfection of cells with plasmid DNA, exchange of post-transfection medium for serum-free medium and collection of cells containing the vector and the culture media. The cells and culture media containing the collected vectors are referred to in this document as collections of crude cells. In yet another system, gene therapy vectors are introduced into insect cells by infection with baculovirus-based vectors. For reviews of these production systems, see, for example, Zhang et al., 2009, Adenovirus-adeno-associated virus hybrid for large-scale recombinant adeno-associated virus production, Human Gene Therapy 20: 922-929, the content each of which is incorporated herein by reference in its entirety. Methods of production and use of these and other AAV production systems are also described in the following US patents, the content of each of which is incorporated into this document by reference in its entirety: 5,139,941; 5,741,683; 6,057,152; 6,204,059; 6,268,213; 6,491,907; 6,660,514; 6,951,753; 7,094,604; 7,172,893; 7,201,898; 7,229,823; and 7,439,065.
    [140] The collection of raw cells can then be the steps of the method in question, such as the concentration of the vector collection, the diafiltration of the vector colleague, the microfluidization of the vector collection, the nuclease digestion of the vector collection, the filtration of the microfluidized intermediate , crude purification by chromatography, crude purification by ultracentrifugation, exchange of buffer by tangential luxury filtration and / or formulation and filtration to prepare the volume vector.
    [141] A two-stage affinity chromatography purification at high salt concentration, followed by chromatography
    Petition 870190107951, of 10/24/2019, p. 105/188
    78/144 anion exchange resin, is used to purify the vector drug product and to remove empty capsids. These methods are described in more detail in International Patent Application No. PCT / US2016 / 065970, filed on December 9, 2016, and their priority documents, US Patent Application No. 62 / 322,071, filed on April 13, 2016 and 62 / 226,357, filed on December 11, 2015 and entitled Scalable Purification Method for AAV9, incorporated by reference into this document. Purification methods for AAV8, International Patent Application No. PCT / US2016 / 065976, filed December 9, 2016 and the priority documents of US Patent Applications Nos. 62 / 322,098, filed on April 13, 2016, and 62 / 266,341, filed on December 11, 2015, and rh10, International Patent Application No. PCT / US16 / 66013, filed on December 9, 2016, and its priority documents, Patent Application No. 62 / 322,055, filed on April 13, 2016, and 62 / 266,347, entitled Scalable Purification Method for AAVrhIO, also filed on December 11, 2015, and for AAV1, the Application for International Patent No. PCT / US2016 / 065974, filed on December 9, 2016, and its priority documents, US Patent Applications Nos. 62 / 322,083, filed on April 13, 2016, and 62 / 26,351, entitled Scalable Purification Method for AAV1, filed on December 11, 2015, all of which are incorporated herein by reference.
    [142] To calculate the content of empty and complete particles, the volumes of VP3 band of a selected sample (for example, in this document, a preparation purified by iodixanol gradient in which the # of GC = # of particles) is plotted compared to charged GC particles. The resulting linear equation (y = mx + c) is used to calculate the number of particles in the peak band volumes of the test article. The number of particles
    Petition 870190107951, of 10/24/2019, p. 106/188
    79/144 (pt) by 20 μΙ_ loaded is then multiplied by 50 to generate particles (pt) / ml_. Pt / mL divided by GC / mL gives the proportion of particles per copies of the genome (pt / GC). Pt / mL-GC / mL generates empty pt / mL. The empty pt / mL divided by pt / mL and x 100 gives the percentage of empty particles.
    [143] Methods for evaluating empty capsids and AAV vector particles with packaged genomes are generally known in the art. See, for example, Grimm et al. Gene Therapy (1999) 6: 1322-1330; Sommer et al. Molec. The R. (2003) 7: 122-128. To test the denatured capsid, methods include subjecting the treated AAV stock to SDS-polyacrylamide gel electrophoresis, consisting of any gel capable of separating the three capsid proteins, for example, a gel gradient containing tris-acetate a 3-8% in the buffer, then run the gel until the sample material is separated and transfer the gel to the nylon or nitrocellulose membranes, preferably nylon. The anti-AAV capsid antibodies are then used as primary antibodies that bind to denatured capsid proteins, preferably an anti-AAV capsid monoclonal antibody, more preferably the anti-AAV-2 B1 monoclonal antibody (Wobus et al. J Virol. (2000) 74: 9281-9293). Then, a secondary antibody is used, one that binds to the primary antibody and contains a means to detect binding to the primary antibody, more preferably an anti-IgG antibody containing a detection molecule covalently linked to it, more preferably an IgG antibody sheep anti-mouse covalently linked to horseradish peroxidase. A method of detecting binding is used to semi-quantitatively determine the binding between the primary and secondary antibodies, preferably a detection method capable of detecting radioactive isotope emissions, electromagnetic radiation or colorimetric changes, more preferably a chemiluminescence detection kit. For example, for SDS-PAGE, samples of fractions of
    Petition 870190107951, of 10/24/2019, p. 107/188
    80/144 column can be taken and heated in SDSPAGE loading buffer containing a reducing agent (eg, DTT) and the capsid proteins were resolved into precast polyacrylamide gels (eg, Novex). Silver staining can be performed using SilverXpress (Invitrogen, CA), according to the manufacturer's instructions or another suitable staining method, that is, by SYPRO ruby or coomassie staining. In one embodiment, the concentration of AAV vector genomes (vg) in column fractions can be measured by real-time quantitative PCR (Q-PCR). The samples are diluted and digested with DNase I (or another suitable nuclease) to remove exogenous DNA. After deactivating the nuclease, the samples are further diluted and amplified using primers and a TaqMan ™ fluorogenic probe specific for the DNA sequence between the primers. The number of cycles required to achieve a defined level of fluorescence (limit cycle, Ct) is measured for each sample in an Applied Biosystems Prism 7700 Sequence Detection System. A plasmid DNA containing sequences identical to those contained in the AAV vector is used to generate a standard curve in the QPCR reaction. The cycle threshold (Ct) values obtained from the samples are used to determine the vector genome titer by normalizing it to the Ct value of the plasmid standard curve. Endpoint assays based on digital PCR can also be used.
    [144] In one aspect, an optimized q-PCR method using a broad spectrum serine protease, for example, proteinase K (as commercially available from Qiagen) is used. More particularly, the optimized qPCR genome titer assay is similar to a standard assay, except that after digestion with DNase I the samples are diluted with proteinase K buffer and treated with proteinase K followed by thermal deactivation. Suitable samples are diluted with proteinase K buffer in an equal amount
    Petition 870190107951, of 10/24/2019, p. 108/188
    81/144 to the sample size. The proteinase buffer K can be concentrated 2 times or more. In general, proteinase K treatment is about 0.2 mg / ml, but can vary between 0.1 mg / ml and about 1 mg / ml. The treatment step is usually carried out at about 55 ° C for about 15 minutes, but can be carried out at a lower temperature (for example, about 37 ° C to about 50 ° C) for a longer period of time. long (for example, about 20 minutes to about 30 minutes) or at a higher temperature (for example, up to about 60 ° C) for a shorter period of time (for example, for about 5 to 10 minutes ). Similarly, deactivation generally takes place at about 95 ° C for about 15 minutes, but the temperature can be lowered (for example, about 70 ° C to about 90 ° C) and the time extended (for example , from about 20 minutes to about 30 minutes). The samples are then diluted (for example, 1000 times) and subjected to a TaqMan analysis, as described in the standard assay.
    [145] In addition, or alternatively, digital drip PCR (ddPCR) can be used. For example, methods for determining self-complementary and single-strand AAV vector genome titers have been described by ddPCR. See, for example, M. Lock et al, Hu Gene Therapy Methods, Hum Gene Ther Methods, April 2014; 25 (2): 11525. doi: 10,1089 / hgtb.2013,131. EPub February 14, 2014.
    [146] In summary, the method for separating rAAVhu68 particles with packaged gene sequences from genome-deficient AAVhu68 intermediates involves subjecting a suspension comprising recombinant AAVhu68 viral particles and AAVhu68 capsid intermediates to fast performance liquid chromatography, where the viral particles of AAVhu68 and intermediates of AAVhu68 are bonded to a strong anion exchange resin balanced at a pH of 10.2 and subjected to a salt gradient while monitoring the eluate for ultraviolet absorbance at about 260 and about
    Petition 870190107951, of 10/24/2019, p. 109/188
    82/144 of 280. Although less ideal for rAAV9hu68, the pH can be in the range of about 10.0 to 10.4. In this method, the total capsids of AAVhu68 are collected from a fraction that is eluted when the A260 / A280 ratio reaches an inflection point. In one example, for the Affinity Chromatography Step, the diafiltered product can be applied to a Capture Select ™ Poros-AAV2 / 9 affinity resin (Life Technologies), which effectively captures the AAV2 / hu68 serotype. Under these ionic conditions, a significant percentage of DNA and residual cellular proteins flow through the column, while the AAV particles are efficiently captured.
    III. Compositions and Uses [147] Compositions containing at least one stock of rAAV (for example, a stock of rAAVhu68 or a stock of mutant rAAV) and an optional vehicle, excipient and / or preservative are provided here. An rAAV stock refers to a plurality of rAAV vectors that are the same, for example, as in the quantities described below in the discussion of concentrations and dosage units.
    [148] As used here, carrier includes any solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic agents and absorption retardants, buffers, carrier solutions, suspensions, colloids and the like. The use of such means and agents for pharmaceutically active substances is well known in the art. Supplementary active ingredients can also be incorporated into the compositions. The phrase pharmaceutically acceptable refers to molecular entities and compositions that do not produce an unpleasant allergic or similar reaction when administered to a host. Delivery vehicles, such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles and the like, can be used for introducing the compositions of the present invention into suitable host cells.
    Petition 870190107951, of 10/24/2019, p. 110/188
    83/144
    In particular, the vector rAAV delivered vector genomes can be formulated for administration either encapsulated in a lipid particle, a liposome, a vesicle, a nanosphere or a nanoparticle or the like.
    [149] In one embodiment, a composition includes a final formulation suitable for delivery to a subject, for example, it is an aqueous liquid suspension buffered to a physiologically compatible pH and salt concentration. Optionally, one or more surfactants are present in the formulation. In another embodiment, the composition can be transported as a concentrate that is diluted for administration to a subject. In other embodiments, the composition can be lyophilized and reconstituted at the time of administration.
    [150] A suitable surfactant, or a combination of surfactants, can be selected from non-ionic non-toxic surfactants. In one embodiment, a difunctional block copolymer surfactant ending in primary hydroxyl groups is selected, for example, as Pluronic® F68 [BASF], also known as Poloxamer 188, which has a neutral pH and an average molecular weight of 8400. Other surfactants and other poloxamers can be selected, namely, non-ionic triblock copolymers composed of a central hydrophobic chain of polyoxypropylene (polypropylene oxide) flanked by two hydrophilic chains of polyoxyethylene (poly (ethylene oxide)), SOLUTOL HS 15 (Macrogol -15 Hydroxystearate), LABRASOL (poly-caprylic glycer), polyoxy-10-oleyl ether, TWEEN (fatty acid and polyoxyethylene sorbitan esters), ethanol and polyethylene glycol. In one embodiment, the formulation contains a poloxamer. These copolymers are usually named with the letter P (of poloxamer) followed by three digits: the first two digits x 100 give the approximate molecular mass of the polyoxypropylene core and the last digit x 10 indicates the percentage of polyoxyethylene. In one mode, the Poloxamer 188 is selected. O
    Petition 870190107951, of 10/24/2019, p. 111/188
    84/144 surfactant can be present in an amount of about 0.0005% to about 0.001% of the suspension.
    [151] The vectors are administered in sufficient quantities to transfect cells and provide sufficient levels of gene transfer and expression to provide a therapeutic benefit without undue adverse effects, or with clinically acceptable physiological effects, which can be determined by those skilled in the medical art. Conventional and pharmaceutically acceptable routes of administration include, but are not limited to, direct delivery to a desired organ (eg, liver (optionally via the hepatic artery), lung, heart, eye, kidney), oral, inhalation, intranasal, parental intrathecal, intratracheal, intraarterial, intraocular, intravenous, intramuscular, subcutaneous, intradermal and other parental routes of administration. Administration routes can be combined, if desired.
    [152] Viral vector dosages will depend mainly on factors such as the condition to be treated, the age, weight and health of the patient and, therefore, may vary between patients. For example, a therapeutically effective human dosage of the viral vector is generally in the range of about 25 to about 1000 microliters to about 100 ml of solution containing concentrations of about 1 x 10 9 to 1 x 10 16 genome virus vector. The dosage will be adjusted to balance the therapeutic benefit against any side effects and such dosages may vary depending on the therapeutic application for which the recombinant vector is employed. The expression levels of the transgene product can be monitored to determine the frequency of dosing resulting in viral vectors, preferably AAV vectors containing the minigene. Optionally, dosage regimens similar to those described for therapeutic purposes can be used for immunization using the compositions of the invention.
    Petition 870190107951, of 10/24/2019, p. 112/188
    85/144 [153] Replication defective virus compositions can be formulated in dosage units to contain an amount of replication defective virus that is in the range of about 1.0 x 10 9 GC to about 1, 0 x 10 16 GC (to treat an average subject of 70 kg in body weight) including all integers or fractional quantities within the range and preferably 1.0 x 10 12 GC to 1.0 x 10 14 GC for a human patient. In one embodiment, the compositions are formulated to contain at least 1x10 9 , 2x10 9 , 3x10 9 , 4x10 9 , 5x10 9 , 6x10 9 , 7x10 9 , 8x10 9 , or 9x10 9 GC per dose, including all integers or quantities fractional within the range. In another embodiment, the compositions are formulated to contain at least 1 x10 10 2x1O 10 3x10 1, 4x1O 10 5x1O 10 6x10 1, 7x1O 10 8x10 1 ° or 9x10 1 GC per dose, including all integers or fractional quantities within the range. In another embodiment, the compositions are formulated to contain at least 1 x10 11 , 2x10 11 , 3x10 11 , 4x10 11 , 5x10 11 , 6x10 11 , 7x10 11 , 8x10 11 , or 9x10 11 GC per dose, including all integers or fractional quantities within the range. In another embodiment, the compositions are formulated to contain at least 1 x10 12 , 2x10 12 , 3x10 12 , 4x10 12 , 5x10 12 , 6x10 12 , 7x10 12 , 8x10 12 , or 9x10 12 GC per dose, including all integers or fractional quantities within the range. In another embodiment, the compositions are formulated to contain at least 1x10 13 , 2x10 13 , 3x10 13 , 4x10 13 , 5x10 13 , 6x10 13 , 7x10 13 , 8x10 13 , or 9x10 13 GC per dose, including all integers or fractional quantities within the range. In another embodiment, the compositions are formulated to contain at least 1x10 14 , 2x10 14 , 3x10 14 , 4x10 14 , 5x10 14 , 6x10 14 , 7x10 14 , 8x10 14 , or 9x10 14 GC per dose, including all integers or fractional quantities within the range. In another embodiment, the compositions are formulated to contain at least 1x10 15 , 2x10 15 , 3x10 15 , 4x10 15 , 5x10 15 , 6x10 15 , 7x10 15 , 8x10 15 , or 9x10 15 GC per dose, including all
    Petition 870190107951, of 10/24/2019, p. 113/188
    86/144 whole numbers or fractional quantities within the range. In one embodiment, for human application the dose can vary from 1x10 10 to about 1x10 12 GC per dose including all integers or fractional amounts within the range.
    [154] These above doses can be administered in a variety of volumes of vehicle, excipient or buffer formulation, ranging from about 25 to about 1000 microliters, or larger volumes, including all numbers within the range, depending on the size of the area to be treated, the viral title used, the route of administration and the desired effect of the method. In one embodiment, the volume of vehicle, excipient or buffer is at least about 25 µl. In one embodiment, the volume is about 50 μΙ_. In another embodiment, the volume is about 75 μΙ_. In another embodiment, the volume is about 100 μΙ_. In another embodiment, the volume is about 125 μΙ_. In another embodiment, the volume is about 150 μΙ_. In another mode, the volume is about 175 μΙ_. In yet another modality, the volume is about 200 μΙ_. In another mode, the volume is about 225 μΙ_. In yet another modality, the volume is about 250 μΙ_. In yet another modality, the volume is about 275 μΙ_. In yet another modality, the volume is about 300 μΙ_. In yet another modality, the volume is about 325 μΙ_. In another mode, the volume is about 350 μΙ_. In another embodiment, the volume is about 375 μΙ_. In another embodiment, the volume is about 400 μΙ_. In another embodiment, the volume is about 450 μΙ_. In another embodiment, the volume is about 500 μΙ_. In another embodiment, the volume is about 550 μΙ_. In another embodiment, the volume is about 600 μΙ_. In another embodiment, the volume is about 650 μΙ_. In another mode, the volume is about 700 μΙ_. In another embodiment, the volume is between about 700 and 1000 μΙ_.
    [155] In certain modalities, the dose can be in the range of about
    Petition 870190107951, of 10/24/2019, p. 114/188
    87/144 from 1 x 10 9 GC / g brain weight to about 1 x 10 12 GC / g brain weight. In certain embodiments, the dose can range from about 3 x 10 10 GC / g brain weight to about 3 x 10 11 GC / g brain weight. In certain embodiments, the dose can be in the range of about 5 x 10 1 ° GC / g of brain mass to about 1.85 x 10 11 GC / g of brain mass.
    [156] In one embodiment, viral constructs can be administered in doses from at least about 1x10 9 GCs to about 1 x 10 15 , or about 1 x 10 11 to 5 x 10 13 GC. The volumes suitable for administering these doses and concentrations can be determined by someone skilled in the art. For example, volumes of about 1 pL to 150 mL can be selected, with the highest volumes being selected for adults. In general, for newborns, an appropriate volume is about 0.5 ml to about 10 ml, for older children, from about 0.5 ml to about 15 ml can be selected. For young children, a volume of about 0.5 ml to about 20 ml can be selected. For children, volumes up to 30 mL can be selected. For pre-teens and teenagers, volumes up to about 50 mL can be selected. In yet other embodiments, a patient can receive intrathecal administration in a volume of about 5 ml to about 15 ml selected or about 7.5 ml to about 10 ml. Other suitable volumes and doses can be determined. The dosage will be adjusted to balance the therapeutic benefit against any side effects and such dosages may vary depending on the therapeutic application for which the recombinant vector is employed.
    [157] The recombinant vectors described above can be delivered to host cells according to published methods. The rAAV, preferably suspended in a physiologically compatible vehicle, can be administered to a human mammal patient or not
    Petition 870190107951, of 10/24/2019, p. 115/188
    88/144 human. In certain embodiments, for administration to a human patient, the rAAV is suitably suspended in an aqueous solution containing saline, a surfactant and a physiologically compatible salt or salt mixture. Suitably, the formulation is adjusted to a physiologically acceptable pH, for example, in the pH range 6 to 9 or pH 6.5 to 7.5, pH 7.0 to 7.7 or pH 7.2 to 7.8. As the pH of the cerebrospinal fluid is from about 7.28 to about 7.32, for intrathecal administration, a pH within this range may be desirable; whereas for intravenous administration, a pH of about 6.8 to about 7.2 may be desirable. However, other pHs within the broadest ranges and these subintervals can be selected for another route of administration.
    [158] In another embodiment, the composition includes a vehicle, diluent, excipient and / or adjuvant. Suitable carriers can be easily selected by one skilled in the art in view of the indication to which the transfer virus is directed. For example, a suitable vehicle includes saline, which can be formulated with a variety of buffer solutions (for example, phosphate buffered saline). Other exemplary vehicles include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil and water. The plug / vehicle must include a component that prevents the rAAV from sticking to the infusion tubing, but does not interfere with the in vivo binding activity to the rAAV. A suitable surfactant, or a combination of surfactants, can be selected from non-ionic non-toxic surfactants. In one embodiment, a difunctional block copolymer surfactant ending in primary hydroxyl groups is selected, for example, as Pluronic® F68 [BASF], also known as Poloxamer 188, which has a neutral pH and an average molecular weight of 8400. Other surfactants and other poloxamers can be selected, namely, copolymers
    Petition 870190107951, of 10/24/2019, p. 116/188
    89/144 nonionic triblocks composed of a central hydrophobic chain of polyoxypropylene (polypropylene oxide) flanked by two hydrophilic chains of polyoxyethylene (poly (ethylene oxide)), SOLUTOL HS 15 (Macrogol-15 Hydroxystearate), LABRASOL (polycaprylic glyceride) , polyoxy-oleyl ether, TWEEN (fatty acid esters and polyoxyethylene sorbitan), ethanol and polyethylene glycol. In one embodiment, the formulation contains a poloxamer. These copolymers are usually named with the letter P (of poloxamer) followed by three digits: the first two digits x 100 give the approximate molecular mass of the polyoxypropylene core and the last digit x 10 indicates the percentage of polyoxyethylene. In one mode, the Poloxamer 188 is selected. The surfactant can be present in an amount of about 0.0005% to about 0.001% of the suspension. In one example, the formulation may contain, for example, a buffered saline solution containing one or more of: sodium chloride, sodium bicarbonate, dextrose, magnesium sulphate (eg magnesium sulphate VELO), potassium chloride, chloride of calcium (eg calcium chloride · 2Η2θ), dibasic sodium phosphate, and mixtures thereof, in water. Suitably, for intrathecal administration, osmolarity is within a range compatible with cerebrospinal fluid (for example, from about 275 to about 290); see, for example, emedicine.medscape.com/article/2093316-overview. Optionally, for intrathecal administration, a commercially available diluent can be used as a suspending agent or in combination with another suspending agent and other optional excipients. See, for example, the Elliotts B® solution [Lukare Medicai]. In other embodiments, the formulation may contain one or more permeation enhancers. Examples of suitable permeation enhancers may include, for example, mannitol, sodium glycolate, sodium taurocholate, sodium deoxycholate, sodium salicylate, sodium caprylate, sodium caprate, sodium lauryl sulfate, polyoxyethylene-9-laurel ether or EDTA.
    Petition 870190107951, of 10/24/2019, p. 117/188
    90/144 [159] Optionally, the compositions of the invention may contain, in addition to the rAAV and carrier (s), other conventional pharmaceutical ingredients, such as preservatives or chemical stabilizers. Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanillin, glycerin, phenol and parachlorophenol. Suitable chemical stabilizers include gelatin and albumin.
    [160] The compositions according to the present invention can comprise a pharmaceutically acceptable carrier, as defined above. Suitably, the compositions described in this document comprise an effective amount of one or more AAVs suspended in a pharmaceutically suitable vehicle and / or mixed with suitable excipients designed for delivery to the subject by injection, osmotic pump, intrathecal catheter, or for delivery by another device or via. In one example, the composition is formulated for intrathecal delivery.
    [161] As used in this document, the term intrathecal administration refers to a route of drug administration through an injection into the spinal canal, more specifically into the subarachnoid space, so that they reach the cerebrospinal fluid (CSF). Intrathecal administration may include lumbar puncture, intraventricular (including intracerebroventricular (ICV)), suboccipital / intracisternal and / or C1-2. For example, the material can be introduced for diffusion through the subarachnoid space by means of lumbar puncture. In another example, the injection can be in the cistern magna.
    [162] As used here, the term intracisternal administration refers to a route of drug administration directly into the cerebrospinal fluid of the cerebellar medulla cisterna, more specifically through a suboccipital puncture or by direct injection into the magna cistern or through a permanently positioned tube.
    Petition 870190107951, of 10/24/2019, p. 118/188
    91/144
    IV. Apparatus and Method for the Administration of a Pharmaceutical Composition in Cerebrospinal Fluid [163] In one aspect, the vectors provided in this document can be administered intrathecally via the method and / or the device provided in this section and further described in FIGURE 7. Alternatively , other devices and methods can be selected. The method comprises the steps of advancing a spinal needle into a patient's cisterna magna, connecting a length of flexible tubing to a hub near the spinal needle and a valve outlet port to an end near the flexible tubing, and then the referred advance and connection steps and after allowing the tubing to self-activate with the patient's cerebrospinal fluid, connect a first container containing an amount of isotonic solution to a valve discharge inlet port and, from there, connect a second container containing a quantity of a pharmaceutical composition to a valve vector inlet port. After connecting the first and second containers to the valve, a path for fluid flow is opened between the vector inlet port and the valve outlet port, and the pharmaceutical composition is injected into the patient through the spinal needle, and , after the injection of the pharmaceutical composition, a path is opened for the flow of fluid through the discharge inlet port and the valve outlet port, and the isotonic solution is injected into the spinal needle to discharge the pharmaceutical composition into the patient.
    [164] In another aspect, a device is provided for intracisternal administration of a pharmaceutical composition. The device includes a first container containing an amount of a pharmaceutical composition, a second container containing an isotonic solution and a spinal needle through which the pharmaceutical composition can be ejected directly from the device into the cerebrospinal fluid, inside a patient's large cistern. The device
    Petition 870190107951, of 10/24/2019, p. 119/188
    92/144 also includes a valve that has a first port connected to the first vessel, a second port connected to the second vessel, an outlet port connected to the spinal needle and a luer closure to control the flow of the pharmaceutical composition and the isotonic solution through the spinal needle.
    [165] As used here, Computed Tomography (CT) refers to a radiograph in which a three-dimensional image of a body structure is constructed by computer from a series of flat cross-sectional images taken along an axis.
    [166] The medical device or device 10, as shown in FIGURE 7, includes one or more vessels, 12 and 14, interconnected via a valve 16. Vases 12 and 14 provide a new source of a pharmaceutical composition, drug, vector or similar substance and a new source of an isotonic solution, such as saline, respectively. Vessels 12 and 14 can be any form of medical device that allows the injection of fluids in a patient.
    [167] For example, each container, 12 and 14, can be supplied in the form of a syringe, cannula or the like. For example, in the illustrated embodiment, container 12 is supplied as a separate syringe, containing a quantity of a pharmaceutical composition and is referred to herein as a vector syringe. For example only, container 12 may contain about 10 cc of a pharmaceutical composition or the like.
    [168] Likewise, container 14 can be provided in the form of a separate syringe, cell or the like that contains an amount of saline and can be referred to as a discharge syringe. For example only, container 14 may contain about 10 cc of saline.
    [169] Alternatively, vessels 12 and 14 can be supplied in different forms of syringes and can be integrated into a single device,
    Petition 870190107951, of 10/24/2019, p. 120/188
    93/144 such as an integrated medical injection device that has a pair of separate chambers, one for the pharmaceutical composition and one for saline. In addition, the size of the chambers or vessels can be provided as needed to contain a desired amount of fluid.
    [170] In the illustrated embodiment, valve 16 is supplied in the form of a 4-way stopcock with a rotating male luer-lock syringe 18. Valve 16 connects vessels 12 and 14 (ie, the vector syringe and the syringe discharge in the illustrated mode), and the rotating male luer-lock opens a path through valve 16, to be opened and closed for each of the vessels 12 and 14. In this way, the path through valve 16 can be closed both for the syringe vector and the discharge syringe or can be opened for a vector syringe or a selected discharge syringe. As an alternative to a 4-way tap, the valve can be a 3-way tap or a fluid control device.
    [171] In the illustrated embodiment, valve 16 is connected to one end of a length of an extension pipe 20 or a similar duct for fluids. Piping 20 can be selected based on a desired length or an internal volume. Just as an example, the tubing can be about 6 to 7 inches long.
    [172] In the illustrated embodiment, an opposite end 22 of tubing 12 is connected to a T-connector extension set 24, which, in turn, is connected to a spinal needle 26. As an example, needle 26 can be a five inch 22 or 25 gauge spinal needle. In addition, optionally, spinal needle 26 can be attached to an introducer needle 28, such as a three and a half inch 18 gauge introducer needle.
    [173] In use, the spinal needle 26 and / or the optional introducer needle
    Petition 870190107951, of 10/24/2019, p. 121/188
    94/144 can be advanced in the patient to the cisterna magna. After advancing the needle, computed tomography (CT) images can be obtained that allow the visualization of needle 26 and / or 28 and the relevant soft tissues (for example, paravertebral muscles, bones, brain stem and spinal cord). The correct placement of the needle will be confirmed by observing the cerebrospinal fluid (CSF) in the center of the needle and by viewing the tip of the needle inside the cisterna magna. Thereafter, the relatively short tubing 20 can be connected to the inserted spinal needle 26 and the 4-way tap 16 can then be connected to the opposite end of the tubing 20.
    [174] The above assembly is allowed to become self-activated with the patient's CSF. Thereafter, the filled normal saline discharge syringe 14 is connected to a 4-way tap discharge inlet port 16 and then the vector syringe 12 containing a pharmaceutical composition is connected to a vector inlet port of the tap 4-way 16. Thereafter, the outlet port of the tap 16 is opened for the vector syringe 12 and the contents of the vector syringe can be slowly injected through valve 16 and the assembled apparatus and to the patient over a period of time. For purposes of example only, this time period can be about 1-2 minutes and / or any other desired time period.
    [175] After the contents of the vector syringe 12 are injected, the rotary lock 18 on tap 16 is turned to a second position so that tap 16 and the needle set can be washed with a desired amount of normal saline. using the filled wash syringe 14. Just as an example, 1 to 2 cc of normal saline can be used, although larger or smaller amounts can be used as needed. The normal saline solution ensures that all or most of the pharmaceutical composition is forced to be injected through the device
    Petition 870190107951, of 10/24/2019, p. 122/188
    95/144 mounted and on the patient, and so that little or nothing of the pharmaceutical composition remains in the mounted device.
    [176] After the assembled device has been washed with saline, the entire assembled device, including the needle (s), the extension tubing, the tap and the syringes are slowly removed from the individual and placed in a surgical tray to dispose of in a biohazard waste container or a rigid container (for the needle (s)).
    [177] A screening process can be performed by a principal investigator, which can lead to an intracisternal procedure (CI). The principal investigator can describe the process, the procedure, the administration procedure itself and all possible security risks so that the individual (or designee) is fully informed. Medical history, concomitant medications, physical examination, vital signs, electrocardiogram (ECG) and laboratory test results are obtained or performed and provided to a neuroradiologist, neurosurgeon and anesthetist for use in screening for patient eligibility screening for the IC procedure.
    [178] In order to allow adequate time to review eligibility, the following procedures should be performed at any time between the first screening visit and up to one week before the study visit. For example, on Day 0, Magnetic Resonance Images (MRI) of head / neck with and without gadolinium (ie, eGFR> 30 mL / min / 1.73 m2) can be obtained. In addition to head / neck MRI, the investigator will determine the need for additional neck assessments through flexion / extension studies. The MRI protocol will include images from T1, T2, DTI, FLAIR and CINE protocols.
    [179] In addition, the head / neck MRA / MRV, according to the institutional protocol (ie, individuals with a history of operations
    Petition 870190107951, of 10/24/2019, p. 123/188
    96/144 intra / transdural may be excluded or need other tests (for example, radionucleotide cisternography)) that allow an adequate assessment of the CSF flow and the identification of possible blockages or lack of communication between the CSF spaces.
    [180] The neuroradiologist, the neurosurgeon and the anesthesiologist discuss and determine each individual's eligibility for CI procedures based on all available information (exams, medical history, physical and laboratory exams, etc.). A preoperative assessment of anesthesia can also be obtained from Day -28 to Day 1, which allows a detailed assessment of the airways, neck (shortened / thickened) and the range of movement of the head (degree of neck flexion), keeping in mind the special physiological needs of a subject with MPS.
    [181] Before a CI procedure, the CT Suite will confirm that the following equipment and drugs are present: Lumbar puncture kit (LP) for adults (provided by institution); BD (Becton Dickinson) 22 or 25 gauge x 3 - 7 ”spinal needle (Quincke bevel); Coaxial introducer needle, used at the interventionist's discretion (for introducing a spinal needle); small 4-hole tap with rotating male luer lock (Spin); T-connector extension set (tubing) with female luer lock adapter, length approximately 6.7 inches; Omnipaque 180 (iohexol), for intrathecal administration; Iodinated contrast for intravenous (IV) administration; 1% lidocaine solution for injection (if not supplied in an adult LP kit); Pre-filled syringe of 10 cc normal saline (sterile); Radiopaque marker (s); Surgical preparation equipment / razor blade; Pads / supports to allow proper positioning of the intubated subject; Endotracheal intubation equipment, general anesthesia machine and mechanical ventilator; Intraoperative neurophysiological monitoring equipment (IONM) (and personnel required); and vector containing
    Petition 870190107951, of 10/24/2019, p. 124/188
    97/144 10cc syringe; prepared and transported to the CT / operating room (OR) according to the separate Pharmacy Manual.
    [182] Informed consent for the procedure will be confirmed and documented in the medical record and / or study file. Separate consent for the radiology and anesthesiology team procedure will be obtained in accordance with institutional requirements. The individual has an intravenous access placed within the appropriate hospital unit in accordance with institutional guidelines (for example, two IV access sites). Intravenous fluids will be administered at the discretion of the anesthesiologist. At the discretion of the anesthesiologist and in accordance with institutional guidelines, the individual can be induced and submitted to endotracheal intubation with the administration of general anesthesia in an appropriate care unit for the patient, waiting area or surgical procedure / computed tomography.
    [183] A lumbar puncture is performed, first to remove 5 cc of cerebrospinal fluid (CSF) and, later, to inject contrast (Omnipaque 180) intrathecally, to assist the visualization of the cisterna magna. Appropriate placement maneuvers can be performed on the individual in order to facilitate the diffusion of the contrast in the cisterna magna.
    [184] Intraoperative neurophysiological monitoring equipment (IONM) is linked to the individual. The individual is placed on the CT scanner table in the lateral or prone position. Adequate staff must be present to ensure the safety of the individual during transport and placement. If deemed appropriate, the subject can be positioned in a way that provides neck flexion to the degree determined to be safe during the preoperative assessment and with the normal neurophysiological monitor signals documented after placement.
    [185] The following team can be confirmed as present and identified on the spot: the interventionist / neurosurgeon who performs the procedure;
    Petition 870190107951, of 10/24/2019, p. 125/188
    98/144 the anesthesiologist and the respiratory technique (s); nurses and medical assistants; CT technicians (or OR); neuropsychology technicians; and the local coordinator. An interval can be completed by the hospital / joint committee protocol to verify the individual, procedure, location, placement and the correct presence of all necessary equipment in the room. The principal investigator on site can then confirm with the team that he / she can continue with the individual's preparation.
    [186] The subject's skin under the skull base is shaved as needed. Computed tomography images are taken, followed by pre-procedure computed tomography with IV contrast, if considered necessary by the interventionist to locate the target site and to visualize vascularization. Once the target site (cisterna magna) is identified and the needle path is planned, the skin is prepared and covered using a sterile technique according to institutional guidelines. A radiopaque marker is placed on the desired skin location, as indicated by the interventionist. The skin under the marker is anesthetized through infiltration with 1% lidocaine. A spinal needle of 22G or 25G is advanced towards the cisterna magna, with the option of using a coaxial introducer needle.
    [187] After advancing the needle, computational tumor images are obtained using the thinnest CT cut thickness possible, using institutional equipment (ideally <2.5 mm). Serial computed tomography images using the lowest possible radiation dose, allowing adequate visualization of the needle and the relevant soft tissues (for example, the paraspinal, bone, brainstem and spinal cord muscles) are obtained. Correct needle placement is confirmed by observing the CSF in the center of the needle and viewing the tip of the needle inside the cistern
    Petition 870190107951, of 10/24/2019, p. 126/188
    99/144 magna.
    [188] The interventionist confirms that the vector syringe is positioned close to, but outside the sterile field. Before handling or administering the pharmaceutical composition in the vector syringe, gloves, a mask and eye protection are placed by the team that assists the procedure within the sterile field.
    [189] The extension tubing is attached to the inserted spinal needle, which is then attached to the 4-way stopcock tap. Once this device is self-activated with the individual's CSF, the discharge syringe with normal 10cc filled saline solution is attached to the discharge port of the 4-way stopcock tap. The vector syringe is then supplied to the interventionist and attached to a vector inlet port on the 4-way stopcock.
    [190] After the stopcock tap exit door is opened for the vector syringe, placing the stopcock rotary stopcock in a first position, the contents of the vector syringe are injected slowly (approximately 1-2 minutes), taking care not to apply excessive force to the syringe plunger during injection. After the contents of the vector syringe are injected, the stopcock stopcock is turned to a second position so that the stopcock stopcock and needle set can be discharged with 1-2cc of saline using the filled discharge syringe attached.
    [191] When ready, the intervener will alert employees that he or she will remove the individual's device. In a single movement, the needle, extension tubing, stop-stopcock and syringes will be slowly removed from the patient and placed on a surgical tray to be disposed of in a biohazardous waste receptacle or rigid container (for the needle ).
    [192] The needle insertion site will be examined for signs
    Petition 870190107951, of 10/24/2019, p. 127/188
    100/144 bleeding or leaking CSF and treated as directed by the investigator. The site is wrapped with gauze, surgical tape and / or Tegaderm dressing, as indicated. The individual is then removed from the computerized tumor scanner and placed on a stretcher. Adequate staff must be present to ensure the safety of the individual during transport and placement.
    [193] Anesthesia is discontinued and individuals will be cared for following institutional guidelines for post-anesthetic care. Neurophysiological monitors are removed from the individual. The head of the stretcher on which the individual is standing should be slightly raised (~ 30 degrees) during recovery. The individual is transported to an appropriate post-anesthetic care unit, in accordance with institutional guidelines. After the individual has regained consciousness properly and is in a stable condition, he or she will be admitted to the appropriate floor / unit for mandatory protocol assessments. Neurological assessments will be followed according to the protocol and the Principal Investigator will supervise patient care in collaboration with the hospital and research staff.
    [194] In one embodiment, a method of administering a composition provided in this document comprises the steps of: advancing a spinal needle into a patient's cisterna magna; connect a length of flexible tubing to a center near the spinal needle and a valve outlet port to the end near the flexible tubing; after said advance and connection steps and after allowing the tubing to be self-activated with the patient's cerebrospinal fluid, connect a first vessel containing an amount of isotonic solution to a valve discharge inlet port and then , connect a second vessel containing a quantity of a pharmaceutical composition to a port
    Petition 870190107951, of 10/24/2019, p. 128/188
    101/144 inlet of the valve vector; after connecting the first and second vessels to the valve, open the way for the fluid to flow between the vector inlet port and the valve outlet port and inject the pharmaceutical composition into the patient through the spinal needle; and, after injecting the pharmaceutical composition, open a path for the fluid to flow through the discharge inlet port and the valve outlet port and inject the isotonic solution into the spinal needle to discharge the pharmaceutical composition into the patient. In certain embodiments, the method also comprises making the appropriate placement of a distal tip of the spinal needle in the cisterna magna before connecting the tubing and valve to the center of the spinal needle. In certain modalities, the confirmation step includes visualizing the distal tip of the spinal needle in the cisterna magna with computerized tumors (CT) images. In certain modalities, the confirmation step includes observing the presence of the patient's cerebrospinal fluid in the center of the spinal needle.
    [195] In the method described above, the valve can be a stopcock type tap with a rotating luer lock adapted to rotate to a first position, allowing the flow from the vector inlet port to the outlet port, at the same time blocks flow through the discharge inlet port and into a second position, which allows flow from the discharge inlet port to the outlet port, while blocking flow through the vector inlet port and the rotating luer closure is positioned in said first position in said second position when said pharmaceutical composition is being discharged into said patient by the isotonic solution. In certain embodiments, after injecting the isotonic solution into the spinal needle to discharge the pharmaceutical composition to the patient, the spinal needle is removed from the patient with the tubing, valve and the first and second vessels connected to them in the form of a set. In certain embodiments, the valve is a stopcock
    Petition 870190107951, of 10/24/2019, p. 129/188
    102/144 4-way with a rotating male luer lock. In certain embodiments, ο the first and second vessels are separate syringes. In certain embodiments, a T-connector is located in the center of the spinal needle and connects the tubing to the spinal needle. Optionally, the spinal needle includes an introducer needle at the distal end of the spinal needle. The spinal needle can be a five-inch spinal needle with a 22 or 24 gauge spinal needle. In certain embodiments, the introducer needle is a 3.5-inch 18-gauge introducer needle.
    [196] In certain respects, the method uses a device that is composed of at least one first container to contain a quantity of a pharmaceutical composition; a second container for containing an isotonic solution; a spinal needle through which the pharmaceutical composition can be ejected directly from the device into the cerebrospinal fluid within a patient's large cistern; and a valve that has a first port connected to the first container, a second port connected to the second container, an outlet port connected to the spinal needle and a luer closure to control the flow of the pharmaceutical composition and the isotonic solution through the spinal needle. In certain embodiments, the valve is a stopcock type tap with a rotating luer closure adapted to rotate to a first position, allowing the flow from the first inlet to the outlet, while blocking flow through the second port inlet and up to a second position, allowing flow from the second inlet to the outlet, while blocking flow through the first inlet. Optionally, the valve is a 4-way stopcock with a rotating male luer closure. In certain embodiments, the first and second containers are separate syringes. In certain embodiments, the spinal needle is connected to the valve through a length of flexible tubing. A T connector can
    Petition 870190107951, of 10/24/2019, p. 130/188
    103/144 connect the tubing to the spinal needle. In certain embodiments, the spinal needle is a five inch 22 or 24 gauge spinal needle. In certain embodiments, the device further comprises an introducer needle attached to a distal end of the spinal needle. Optionally, the introducer needle is a 3.5-inch 18 gauge introducer needle.
    [197] This method and device can each be used to administer the compositions described herein. Alternatively, other methods and devices can be used for such an intrathecal administration.
    [198] In certain embodiments, a composition is provided that comprises the rAAVhu68.anti-HER2 antibody, so that AAV vectors carry the nucleic acid expression cassettes that encode the immunoglobulin constructs and the regulatory sequences that direct the expression of immunoglobulin in the selected cell. After the administration of the vectors to the CNS, the vectors deliver the expression cassettes to the CNS and express the protein immunoglobulin constructs in vivo. The use of the compositions described herein in an antineoplastic method is described, as well as the use of these compositions in antineoplastic regimens, which may optionally involve the delivery of one or more other antineoplastic agents or other actives.
    [199] A composition can contain a single type of AAVhu68 vector, as described herein, which contains the expression cassette for in vivo delivery of the antineoplastic immunoglobulin construct. Alternatively, a composition can contain two or more different AAV vectors, each of which has packed different expression cassettes in it. For example, the two or more different AAVs may have different expression cassettes that express immunoglobulin polypeptides that assemble in vivo to form a single functional immunoglobulin construct. In another example, the two or more AAVs may have
    Petition 870190107951, of 10/24/2019, p. 131/188
    104/144 different expression cassettes expressing immunoglobulin polypeptides for different targets, for example, two provide two functional immunoglobulin constructs (for example, an anti-Her2 immunoglobulin construct and a second antineoplastic immunoglobulin construct). In yet another alternative, the two or more different AAVs can express immunoglobulin constructs targeting the same target, in which one of the immunoglobulin constructs has been modified to eliminate binding to FcRn and a second immunoglobulin construct that maintains its capacity or has capacity improved connection to FcRn. This composition can be useful to simultaneously provide antibodies with greater retention in the brain area and antibodies for systemic delivery of the immunoglobulin construct.
    [200] Optionally, one or both of the immunoglobulin constructs described herein increased ADCC activity. A regimen as described herein may comprise, in addition to one or more of the combinations described herein, additional combination with one or more antineoplastic biological drugs, small molecule antinoplastic drug, chemotherapeutic agent, immunological enhancers, radiation, surgery and the like. A biological drug as described herein, is based on a peptide, polypeptide, protein, enzyme, nucleic acid molecule, vector (including viral vectors) or the like.
    [201] Suitably, the compositions described in this document comprise an antineoplastic effective amount of one or more AAVhu68 suspended in a pharmaceutically suitable vehicle designed for delivery to the subject by injection, osmotic pump, intrathecal catheter, or for delivery by another device or route. In one example, the composition is formulated for intrathecal delivery. As used herein, intrathecal delivery includes an injection into the spinal canal, more specifically into the subarachnoid space. However, other delivery routes can be selected and vehicles pharmaceutically
    Petition 870190107951, of 10/24/2019, p. 132/188
    105/144 acceptable for AAV compositions, including, for example, delivery of intracranial, intranasal, intracisternal, intracerebrospinal fluid, among other suitable direct or systemic routes, that is, the Ommaya reservoir.
    [202] The compositions can be formulated in dosage units to contain an amount of AAV that is in the range of about 1 χ 10 9 copies of the genome (GC) to about 5 χ 10 13 GC (to treat an average subject of 70 kg in body weight). In one embodiment, a lumbar puncture is performed in which about 15 ml_ (or less) to about 40 ml_ of CSF are removed and in which the vector is mixed with the CSF and / or suspended in a compatible carrier and delivered to the subject . In one example, the vector concentration is about 3 x 10 13 GC, but other amounts, such as about 1 χ 10 9 GC, about 5X 10 9 GC, about 1 X 10 1 ° GC, about 5 X 10 1 ° GC, about 1 X 10 11 GC, about 5 X 10 11 GC, about 1 X 10 12 GC, about 5 X 10 12 GC, or about 1.0 x 10 13 GC.
    [203] In one embodiment, the compositions described herein are used in a method to slow the growth of a tumor. In yet another embodiment, the compositions described herein are useful for decreasing the size of the tumor in a subject. In an additional embodiment, the compositions described herein are useful in reducing the number of cancer cells in a non-solid tumor cancer. In another embodiment, a composition as provided herein is used in a method to increase overall survival and / or progression-free survival in a patient. Antineoplastic immunoglobulin constructs are selected with a view to the neoplasm to be treated. For example, for the treatment of metastatic breast cancer in the brain, an expression cassette for an anti-HER antibody can be designed in a recombinant AAV, as described here. Optionally, the AAV compositions as described herein are administered in the absence of an agent
    Petition 870190107951, of 10/24/2019, p. 133/188
    106/144 additional pharmacological or chemical extrinsic, or other physical disruption of the blood-brain barrier. In a combination therapy, the immunoglobulin construct delivered by the AAV described here is administered before, during or after the start of therapy with another agent, as well as any combination thereof, that is, before and during, before and after, during and after or before, during and after the initiation of antineoplastic therapy. For example, AAV can be administered between 1 and 30 days, preferably 3 and 20 days, more preferably between 5 and 12 days before starting radiation therapy. In another embodiment of the invention, chemotherapy is administered concomitantly with, or more preferably, subsequent to, AAV-mediated immunoglobulin therapy (antibody). In still other embodiments, the compositions of the invention can be combined with other biological products, for example, recombinant monoclonal antibody drugs, antibody-drug conjugates or the like. In addition, combinations of different immunoglobulin constructs delivered by AAV, such as those discussed above, can be used in such regimes. Any suitable method or route can be used to administer a composition containing AAVhu68.anti-Her2 as described herein and, optionally, to co-administer antineoplastic agents and / or antagonists to other receptors. The antineoplastic agent regimens used in accordance with the invention include any regimen that is believed to be ideally suited for the treatment of the patient's neoplastic condition. Different neoplasms may require the use of specific antitumor antibodies and specific antineoplastic agents, which will be determined from patient to patient. Routes of administration include, for example, systemic, oral, intravenous, intraperitoneal, subcutaneous or intramuscular administration. The dose of the antagonist administered depends on several factors, including, for example, the type of antagonists, the type and severity of the tumor to be treated and the route of administration of the
    Petition 870190107951, of 10/24/2019, p. 134/188
    107/144 antagonists.
    [204] It should be noted that the term one or one refers to one or more. Accordingly, the terms one (or one), one or more and at least one are used interchangeably in this document.
    [205] The words understand, understand and understand must be interpreted inclusive rather than exclusively. The words consist, consist and their variants must be interpreted exclusively, and not inclusive. Although several modalities in the report are presented using the term comprising, in other circumstances a related modality must also be interpreted and described using consisting of or consisting essentially of.
    [206] As used in this document, the term about means a variability of 10% (± 10%) with respect to the given reference, unless otherwise specified.
    [207] As used in this document, disease, disorder and condition are used interchangeably to indicate an abnormal state in a subject.
    [208] Unless otherwise defined in this specification, the technical and scientific terms used in this document have the same meaning as that understood in the art and by reference to published texts that provide those skilled in the art with general guidance for several of the terms used in this application .
    [209] The term expression is used in this document in its broadest sense and comprises the production of RNA or RNA and protein. With regard to RNA, the term "expression" or "translation" refers in particular to the production of peptides or proteins. The expression can be transient or stable.
    [210] As used in this document, the term NAb title measures the amount of neutralizing antibodies (for example, anti NAb
    Petition 870190107951, of 10/24/2019, p. 135/188
    108/144
    AAV) that neutralizes the physiological effect of your target epitope (for example, an AAV). Anti-AAV NAb titers can be measured as described in, for example, Calcedo, R., et al., Worldwide Epidemiology of Neutralizing Antibodies to Adeno-Associated Viruses. Journal of Infectious Diseases, 2009. 199 (3): p. 381-390, which is incorporated herein by reference.
    [211] As used herein, an expression cassette refers to a nucleic acid molecule that comprises a coding sequence, a promoter and may include other regulatory sequences for it. In certain embodiments, a vector genome can contain two or more expression cassettes. In other modalities, the term "transgene" can be used interchangeably with "expression cassette". Typically, such an expression cassette for generating a viral vector contains the coding sequence for the gene product described herein, flanked by packaging signals from the viral genome and other expression control sequences, such as those described herein.
    [212] The abbreviation sc refers to self-complementarity. Self-complementary AAV refers to a construct in which a coding region carried by a recombinant AAV nucleic acid sequence was designed to form an intramolecular double-stranded DNA template. After infection, instead of waiting for cell-mediated synthesis of the second strand, the two complementary scAAV halves will combine to form a double-stranded DNA (dsDNA) unit that is ready for immediate replication and transcription. See, for example, DM McCarty et al. Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis, Gene Therapy, (August 2001), vol. 8, number 16, pages 1248-1254. Self-complementary AAVs are described, for example, in U.S. Patent Nos.
    Petition 870190107951, of 10/24/2019, p. 136/188
    109/144
    6,596,535; 7,125,717; and 7,456,683, each of which is incorporated by reference in its entirety by reference.
    [213] As used herein, the term operationally linked refers to expression control sequences that are contiguous to the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest.
    [214] The term heterologous, when used with reference to a protein or nucleic acid, indicates that the protein or nucleic acid comprises two or more sequences or subsequences that are not found in the same relationship with each other in nature. For example, nucleic acid is generally produced recombinantly, having two or more sequences of unrelated genes arranged to produce a new functional nucleic acid. For example, in one embodiment, the nucleic acid has a gene promoter arranged to direct the expression of a coding sequence for a different gene. Thus, with reference to the coding sequence, the promoter is heterologous.
    [215] A virus with defective replication or viral vector refers to a synthetic or artificial viral particle in which an expression cassette containing a gene of interest is packaged in a viral capsid or envelope, where any viral genomic sequence is also packaged within the viral capsid. or envelope are deficient in replication; that is, they cannot generate progeny virions, but retain the ability to infect target cells. In one embodiment, the viral vector genome does not include the enzyme coding genes needed to replicate (the genome can be engineered to be serum-free - containing only the gene of interest flanked by the signals needed for amplification and packaging of the artificial genome), but these genes can be supplied during production. Therefore, it is considered safe for use in gene therapy, since replication and
    Petition 870190107951, of 10/24/2019, p. 137/188
    110/144 infection by progeny virions cannot occur, except in the presence of the viral enzyme required for replication.
    [216] In many cases, rAAV particles are said to be resistant to DNase. However, in addition to this endonuclease (DNase), other endonucleases and exonucleases can still be used in the purification step described here, to remove contaminating nucleic acids. These nucleases can be selected to degrade single-stranded DNA and / or double-stranded DNA and RNA. Such steps can contain a single nuclease or mixtures of nucleases targeting different targets, and can be endonucleases or exonucleases.
    [217] The term nuclease-resistant indicates that the AAV capsid has been completely assembled around the expression cassette, which is designed to deliver a gene to a host cell and protects these genomic sequences from degradation (digestion) during the incubation steps nuclease cells designed to remove nucleic acids that may be present in the production process.
    [218] As used herein, an effective amount refers to the amount of the rAAV composition that delivers and expresses to the target cells an amount of the vector genome gene product. An effective amount can be determined based on an animal model, rather than a human patient. Examples of a suitable murine model are described in this document.
    [219] In certain embodiments, an rAAV or composition as provided herein excludes an anti-influenza antibody or immunoglobulin construct. In certain embodiments, an rAAV or composition as provided herein excludes a spinal muscular atrophy (SMA) gene or SMN coding sequence.
    [220] The term translation in the context of the present invention refers to a process in the ribosome, in which an mRNA chain controls the assembly of an amino acid sequence to generate a protein or
    Petition 870190107951, of 10/24/2019, p. 138/188
    111/144 a peptide.
    [221] As used throughout this specification and the claims, terms comprising, containing, including and variants thereof include other components, elements, integers, steps and the like. On the other hand, the term consisting and its variants are exclusive of other components, elements, integers, steps and the like.
    [222] It should be noted that the term one or one, referring to one or more, for example, an intensifier, is understood to represent one or more intensifiers. Thus, the terms one (or one), one or more and at least one can be used interchangeably in this document.
    [223] As described above, the term “about” when used to modify a numerical value means a variation of ± 10%, unless otherwise specified.
    [224] The following examples are illustrative only and are not intended to limit the present invention.
    EXAMPLES [225] In certain embodiments, the AAVhu68 capsid was found to have better AAV9 yield, which is also in Clade F. One or both of the amino acid changes, glutamic acid (Glu) at position 67 and valine (Vai) in position 157 you can see this increase in yield. In certain embodiments, vectors containing AAVhu68 capsids provide at least a 15% increase in the yield of the packaged vector compared to vectors based on AAV9. In a comparison between AAVhu68 and AAVrhIO, it was found that AAVhu68 provides better transduction efficiency than AAVrhIO at low doses (for example, about 1 x 10 9 ) after intracerebroventricular administration.
    EXAMPLE 1
    Petition 870190107951, of 10/24/2019, p. 139/188
    112/144
    A. Identification of AAVhu68 [226] Tissue DNA was extracted from human tissue samples as a PCR model with QIAamp columns (Qiagen) following the manufacturer's recommendations with the following modifications. The DNA polymerase Q5 (High Fidelity Mix 2X Q5® Hot Start, NEB) was chosen for its extraordinary high fidelity and robust efficiency to recover the VP1 gene from AAVs in the samples, as described by Gao, et al. [Proc Natl Acad Sei USA, 2002 Sep 3, 99 (18): 1185411859 (Epub 2002 Aug 21)] with the modified starter set as follows: in place of AV1NS, GCTGCGYCAACTGGACCAATGAGAAC initiator, prm504, [SEQ ID NO: 7 ] was used and in place of the AV2CAS reverse primer, prm505 CGCAGAGACCAAGTTCAACTGAAACGA, [SEQ ID NO: 8], was used. The PCR conditions were modified as follows:
    μΙ- Water 9 prm504 1.25 prm505 1.25 mold 1 2X Q5 12.5
    PCR program
    Time (seconds) Cycle (s) 98 30 1 98 10 50 59 10 72 93 72 120 1
    [227] The ~ 3 kb PCR bands were cut from the gel; The DNA was extracted with the QIAquick Gel Extraction Kit (Qiagen) and cloned in the Zero Blunt® TOPO® PCR cloning kit (Thermo Fisher Scientific). The
    Petition 870190107951, of 10/24/2019, p. 140/188
    113/144 plasmids were sequenced to obtain the total length of the AAV VP1 gene. For most samples, at least three plasmids were fully sequenced and consensus sequences were designed as the final AAV sequence for that sample.
    [228] The acquired nucleic acid sequence encoding the AAVhu68 vp1 capsid protein provided in SEQ ID NO: 1. See also FIGs. 2A-2C. The amino acid sequence of AAVhu68 vp1 provided in FIGURE 1 and SEQ ID NO: 2. Compared to AAV9, AAVhu31 and AAVhu32, two mutations (A67E and A157V) were found to be critical in AAVhu68 (circled in FIGURE 1).
    [229] This amplification method also provided a spacer sequence between the vp1 coding sequence and the rep coding sequences. This coding sequence is: atgacttaaaccaggt, SEQ ID NO: 9. The coding sequence for rep52 of AAVhu68 is reproduced in SEQ ID NO: 3. The sequence of the rep52 protein is also reproduced in SEQ ID NO: 4.
    [230] Plasmid pAAV2 / hu68 trans was then produced by carrying the hu68 VP1 gene in a pAAV2 / 9 backbone in place of the AAV9 VP1 gene, in order to assess packaging efficiency, yield and transduction properties. Plasmid pAAV2 / 9 contains AAV2 5 'and 3' ITRs flanking the capsid gene and is available from the Penn Vector Core [University of Pennsylvania, Phila, PA US, pennvectorcore.med.upenn.edu].
    B. Characterization of AAVhu68 [231] Although this phenomenon has not been previously observed or described in adenoassociated virus capsids, it has been found that other proteins and peptides are susceptible, both in vivo and in vitro, to a variety of chemical modifications. One of the most frequent changes is the deamidation of asparagine, a spontaneous non-enzymatic reaction. In general, the half-time deamidation of
    Petition 870190107951, of 10/24/2019, p. 141/188
    114/144 asparaginil under physiological conditions (pH 7.4, 37 ° C) varies between about 1 and 1000 days. A similar series of reactions occurs in the glutamine to glutamate residues, but these reactions are much slower than those of their asparagine counterparts.
    [232] In short peptides, the formation of cyclic intermediates is controlled by the primary sequence, while in proteins the secondary, tertiary and quaternary structures have an additional effect. Thus, the rate of deamidation of each protein amide is determined exclusively. Spectrometric identification of deamidated peptide masses is relatively simple, as deamidation increases the mass of the intact molecule +0.984 Da (the mass difference between the -OH and -NH2 groups). Since deamidation is a stable modification in the gas phase, MS / MS spectra can reveal the position of deamidation, even in the presence of several potential deamidation sites.
    [233] Four AAVhu68 vectors were produced using one of the four vector genomes that are not relevant to this study, each produced using conventional triple transfection methods in 293 cells. For a general description of these techniques, see, for example, Bell CL, et al., “The AAV9 receptor and its modification to improve in vivo lung gene transfer in mice”, J Clin Invest. 2011; 121: 24272435. Briefly, a plasmid encoding the sequence to be packaged (a gene product expressed from a chicken β-actin promoter, an intron and a poly A growth hormone) flanked by inverted AAV2 terminal repeats, was packaged by triple transfection HEK293 cells with plasmids encoding the AAV2 rep gene and the AAVhu68 cap gene and an adenovirus helper plasmid (pAdAF6). The resulting AAV viral particles can be purified using CsCI gradient centrifugation, concentrated and frozen for later use.
    Petition 870190107951, of 10/24/2019, p. 142/188
    115/144 [234] Denaturation and alkylation: to 100 pg of the thawed viral preparation (protein solution), 2 μΙ of 1M Dithiothreitol (DTT) and 2 μΙ of 8M guanidine hydrochloride (GndHCI) are added and incubated at 90 ° C for 10 minutes. Allow the solution to cool to room temperature, add 5 μΙ of freshly prepared 1M iodoacetamide (AMI) and incubate for 30 minutes at room temperature in the dark. After 30 minutes, quench the alkylation reaction by adding 1 μΙ_ of 1M DTT.
    [235] Digestion: To the denatured protein solution, 20mM ammonium bicarbonate, pH 7.5-8, are added in a volume that dilutes the final concentration of GndHCI in 800mM. Protease solution (trypsin or chymotrypsin) is added to a 1:20 protease to protein ratio and incubate at 37 ° C overnight. After digestion, TFA is added to a final 0.5% to quench the digestion reaction.
    [236] Mass Spectrometry: Approximately 1 microgram of the combined digestion mixture is analyzed by UHPLC-MS / MS. The LC is performed on a UltiMate 3000 RSLCnano system (Thermo Scientific). Mobile phase A is MilliQ water with 0.1% formic acid. Mobile phase B is acetonitrile with 0.1% formic acid. The LC gradient runs from 4% B to 6% B over 15 min, then to 10% B for 25 min (40 minutes in total) and then to 30% B for 46 min (86 minutes in total). The samples are loaded directly into the column. The column size is 75 cm x 15 um ID and is packed with 2 micron C18 media (Acclaim PepMap). The LC is connected to a quadrupole-Orbitrap mass spectrometer (Q-Exactive HF, Thermo Scientific) via ionization by nanoflex electrospray using a source. The column is heated to 35 ° C and an electrospray voltage of 2.2 kV is applied. The mass spectrometer is programmed to acquire tandem mass spectra for the top 20 ions. Total resolution of MS to 120,000 and resolution of MS / MS to 30,000. The normalized collision energy is set to 30, automatic gain control for
    Petition 870190107951, of 10/24/2019, p. 143/188
    116/144 e5, maximum fill MS for 100 ms, maximum fill MS / MS for 50 ms.
    [237] Data processing: The RAW data files of the mass spectrometer were analyzed by BioPharma Finder 1.0 (Thermo Scientific). Briefly, all research required 10 ppm of tolerance to precursor mass, 5ppm of tolerance to fragment mass, triptych divination, up to 1 missed divination, fixed modification of cysteine alkylation, variable modification of methionine / tryptophan oxidation, deamidation of asparagine / glutamine, phosphorylation, methylation and amidation.
    [238] In the following table, T refers to trypsin and C refers to chymotrypsin.
    Modification Enzyme T T T T Ç Ç Ç Ç T T T% Roof 93.6 92 93.1 92.5 90.2 89.7 91.1 88.9 98.9 97 94.6 92.4 + Deamidation (Desamide) ~ N35 N57 +Desamide 87.6 95.5 89.3 88.2 90.5 96.3 86.4 84.8 100.0 100.0 99.0 92.7 N66 +Desamide 4.7 N94 +Desamide 11.3 10.9 11.0 5.3 11.6 10.4 10.8 5.6 5.0 11.1 5.4 16.0 N113 +Desamide 1.8-N253 +Desamide 17.7 22.0 21.1 15.0 17.0 22.6 20.5 15.6 4.2 5.5 Q259 +Desamide 35.2 25.6 21.035.4 26.3 20.9 9.2 -N270 +Desamide 16.4 25.1 23.2 16.6 15.9 24.9 23.5 16.1 0.2 -N304 +Desamide 2.6 2.9 2.8 1.3 2.5 2.8 2.9 1.3 16.6 10.3 -N314 +Desamide 6.5 N319 +Desamide 0.3 2.8 2.8 0.22.9 2.8 0.2 N329 +Desamide 72.7 85.6 89.1 86.8 71.0 87.2 88.7 84.7 85.5 79.4 78.9 91.8
    Petition 870190107951, of 10/24/2019, p. 144/188
    117/144
    N336 +Desamide30.8 9.3 100.031.0 9.2 95.7 -N409 +Desamide 21.3 22.9 23.9 24.0 22.0 23.4 24.7 24.2 N452 +Desamide 98.8 99.7 99.2 100.0 98.9 97.3 98.1 95.2 98.2 68.7 67.4 49.4 N477 +Desamide 4.4 4.3 4.3 2.6 4.5 4.4 4.3 2.6 0.8N512 +Desamide 97.5 97.9 95.3 95.7 92.2 91.8 99.2 96.1 99.7 98.2 87.9 75.7 -N515 +Desamide 8.2 21.0 16.08.3 21.0 16.5 0.0 2.5 3.015.1 -Q599 +Desamide 4.0 15.4 10.1 13.6 4.0 15.5 10.0 13.8 15.8 N628 +Desamide 5.35.65.4 0.0 5.4 0.0 N651 +Desamide 0.9 1.6 1.60.5 N663 +Desamide 3.43.5 3.7 3.4 0.0 3.4 3.6 N709 +Desamide 0.6 0.8 20.2 0.6 0.6 0.8 19.8 0.6 0.3 1.3 0.1 0.2 N735 25.0 42.721.7 + Acetylation (Ac): K332 + Ac 100.0 ~ K693 + Ac 13.013.5~ K666 + Ac 93.8 ~ K68 + Ac59.2 + Isomerization (ISO): D97 + Iso 0.5 0.4 0.4 0.2 0.50.4 0.2 D107 + Iso0.30.30.3 D384 + Iso 0.8 0.9 + Phosphorylation (phosphate) S149 + Phos 5.8 5.7 5.2 9.8 5.7 5.9 5.2 9.9 ~ S499 + Phos 30.6 ~ T569 + Phos 0.9 ~ S586 + Phos3.6 + Oxidation ~ W23 + Oxi4.7 5.5 4.8 5.5W247 + Oxi 1.5 0.4 0.71.4 W247 + Oxi in quinurenine0.1 0.1 W306 + Oxi 0.7 0.9 1.6 1.8 0.7 1.0 1.6 1.8
    Petition 870190107951, of 10/24/2019, p. 145/188
    118/144
    W306 + Oxidation in quinurenine 0.3 0.3M404 + Oxi 0.10.20.10.2M436 + Oxi 4.910.2 23.0 4.810.2 22.6 ~ M518 + Oxi 29.91.5 10.6 29.91.5 10.5 ~ M524 + Oxi 18.8 31.6 52.718.4 31.1 52.5 14.2 M559 + Oxi 19.0 21.6 19.6 20.9 19.6 21.3 20.1 20.9 ~ M605 + Oxi 12.2 15.2 12.8 14.8 W619 + Oxi 1.00.6 1.5 1.00.6 1.5 W619 + OxidizedDog 20.3~ M640 + Oxi 23.5 64.2 24.622.4 21.1 25.6W695 + Oxi 0.30.4 0.4 0.30.4 0.4+ Amidation ~ D297 + Amide-Dog72.973.3
    239] In the case of AAVhu68 capsid protein, 4 residues (N57, N329, N452, N512) routinely exhibit high levels of deamidation and in most cases> 90% in several batches. Additional asparagine residues (N94, N253, N270, N304, N409, N477) and Q599) also exhibit deamidation levels of up to -20% in multiple batches. Deamidation levels were initially identified through trypsin digestion and verified with chymotrypsin digestion.
    EXAMPLE 2 - Yield of AAVhu68 vectors [240] Vectors AAVhu68 and AAV9 were generated and evaluated carrying several markers, such as GFP and LacZ. Each of the vectors was generated using the triple transfection technique in 293 cells, as described by Gao et al [Gao, Guang-Ping, et al. Novel adeno-associated viruses from rhesus monkeys as vectors for human gene therapy. Proceedings of the National Academy of Sciences 99.18 (2002): 1185411859].
    A. Fra / SpAAVhu68 Plasmid Production [241] The nucleic acid sequence encoding the vp1 capsid protein provided in SEQ ID NO: 1.
    [242] Plasmid pAAV2 / hu68 trans was produced by carrying ο
    Petition 870190107951, of 10/24/2019, p. 146/188
    119/144 hu68 VP1 gene in a pAAV2 / 9 backbone in place of the AAV9 VP1 gene, in order to evaluate packaging efficiency, yield and transduction properties. Plasmid pAAV2 / 9 contains AAV2 5 'and 3' ITRs flanking the capsid gene and is available from the Penn Vector Core [University of Pennsylvania, Phila, PA US, pennvectorcore.med.upenn.edu].
    B. Yield of AAVhu68 vectors [243] 293 cells were cultured and maintained in DMEM, 1X (Dulbecco's modification of Eagle's minimum essential medium) with 4.5 g / L of glucose, L-glutamine & sodium pyruvate supplemented with 10% fetal bovine serum under the atmosphere with 5% CO2 at 37 ° C. Transfections were performed as described by Gao et al. [Gao, GuangPing, et al. Novel adeno-associated viruses from rhesus monkeys as vectors for human gene therapy. Proceedings of the National Academy of Sciences 99.18 (2002): 11854-11859.] With the vector plasmid replaced by pAAV2 / hu68 or pAAV2 / 9. The transgene (expression cassette) used was CB7.CI.ffl_uciferase.RBG. The transfected cells were further grown in 6-well plates. The total cell lysate, as well as the supernatant, were collected for virus quantification through TaqMan analysis (Applied Biosystems) using probes and primers targeting the polyA region of the transgene rabbit beta-globin (expression cassette) as described in Gao et al [Gao, Guangping, et al. Purification of recombinant adeno-associated virus vectors by column chromatography and its performance in vivo. Human gene therapy 11.15 (2000): 2079-2091]. The yields of six plasmids pAAV2 / 9 and six pAAV2 / hu. 68 plasmids were compared in a 6-well plate, head to head, in terms of the supernatant titer and the total lysate titer. Each plasmid was from a colony of individual bacteria.
    [244] The yield of AAVhu68 was found to be similar
    Petition 870190107951, of 10/24/2019, p. 147/188
    120/144 to that of AAV9 in terms of total lysate (FIGURE 3A, n = 6, p = 0.42). However, in the supernatant, the yield of AAVhu68 was significantly higher than that of AAV9 (FIGURE 3B, n = 6, p = 0.0003). Thus, it was shown that AAVhu68 is a better vector compared to AAV9 in terms of production, since the supernatant is harvested during the cell stack scale and virus production.
    EXAMPLE 3 - INAVIVO TRANSDUCTION OF AAVHU68.LACZ [245] AAVhu68.CB7.nLacZ (also referred to as AAVhu68.LacZ) was generated by inserting a sequence encoding bacterial β-galactosidase located in the nucleus (nLacZ) and then produced as described in Example 2. To evaluate the packaging efficiency, yield, transduction properties, transduction efficiency and tropism of AAVhu68 in vivo, the mice were injected with 5 X 10 11 copies of the AAVhu68 genome. Vector LacZ via various methods of administration, such as intravenous, intramuscular and intranasal administration. Muscle, lung, liver and heart were collected after sacrificing the mice two weeks after administration of the vector. Frozen sections of each organ were prepared, processed and analyzed as a conventional protocol detecting the expression of the LacZ gene [Bell, Peter, et al. An optimized protocol for detection of E. coli β-galactosidase in lung tissue following gene transfer. Histochemistry and cell biology 124.1 (2005): 77-85.]. A positive LacZ stain shown in blue (FIGURES 4A-4C) indicates successful AAVhu68 transduction.
    [246] As shown in FIG 4A, after the vectors introduced into the mice by intravenous (IV) injection, all the tested organs (heart, liver, lung and muscle) demonstrated AAVhu68 transduction while a tropism favoring heart and liver was observed on lung and muscle. After the vectors introduced in the mice by intramuscular injection (IM), heart, liver and muscle
    Petition 870190107951, of 10/24/2019, p. 148/188
    121/144 demonstrated a high rate of AAVhu68 transduction, while no detectable transduction in the lung was observed. If intranasal administration was performed, dispersed transduction was observed in the heart, liver, muscle and lung.
    [247] These results revealed that AAVhu68 demonstrated high transduction efficiency and a wide tropism of tissues / organs.
    EXAMPLE 4 - In vivo transduction of AAVhu68.GFP compared to AAV9.GFP [248] AAVhu68.GFP and AAV9.A GFP were generated by inserting a gene that encodes the green fluorescent protein (GFP) as the genes that are then produced as described in Example 2. To assess the packaging efficiency, yield, transduction properties, transduction efficiency and tropism of AAVhu68 and AAV9 in vivo, the mice were administered with AAVhu68.GFP or AAV9.GFP at doses of 1x10 10 GC or 1x10 11 GC. Brain, muscle, lung, liver and heart were collected after sacrificing the mice two weeks after administration of the vector. Frozen sections of each organ were prepared and processed to visualize GFP expression as described by Wang et al [Wang L, et al., Hum Gene Ther. November 2011; 22 (11): 1389-401; Wang L. et al., Mol Ther. 2010 Jan; 18 (1): 126-34]. A positive GFP stain shown in green (FIGURES 5A-5C and FIGURES 6A-6D) indicates successful transduction of the tested vectors.
    [249] Sections of various regions of the brain (hippocampus, motor cortex and cerebellum) of mice with intracerebroventricular administration of the vectors were investigated. Transduction of AAV vectors was observed in all tested hippocampus samples, except one from mice injected with 1x10 10 GC of AAV9.GFP. A better transduction of AAVhu68.GFP compared to AAV9 was observed
    Petition 870190107951, of 10/24/2019, p. 149/188
    122/144 vado in the motor cortex. In addition, transduction into the cerebellum of AAVhu68.A GFP was observed when mice were injected with only 1x10 11 GC of the vector. Therefore, AAVhu68 exhibited a higher transduction efficiency, in addition to a broader tropism in the brain compared to AAV9.
    [250] In another experiment, several organs, such as liver, kidney, heart and pancreas, from mice administered with AAVhu68.GFP intravenously were prepared and processed as described by Wang et al. [Wang L, Calcedo R, Bell P, J Lin, Grant RL, Siegel DL, Wilson JM, Hum Gene Ther. 2011 Nov; 22 (11): 1389-401; Wang L, Calcedo R, Wang H, Bell P, Grant R, Vandenberghe LH, Sanmiguel J, Morizono H, Batshaw ML, Wilson JM, Mol Ther. 2010 Jan; 18 (1): 126-34]. A positive GFP signal shown in green indicates a successful transduction of said AAV vectors. Bright field images shown in black and white were provided for the organ's morphology, while the corresponding red fluorescent channel was provided as a negative control.
    [251] Strong positive signal shown in green was observed in the liver, while kidney, heart and pancreas also demonstrated transduction of the referred vector, indicating a wide tissue / organ tropism of the AAVhu68 vector.
    EXAMPLE 5 - Production and in vivo transduction of AAV vectors with A67E and A157V mutation [252] To increase the yield and / or packaging efficiency of a recombinant adenoassociated vector (rAAV), an AAV capsid gene to express a vp1 protein with a Glu at amino acid position 67 and / or a Vai at amino acid position 157 is manipulated for AAV Vectors, such as AAV9, AAVhu31 and AAVhu32, where the numbering of amino acid residues is based on AAVhu68 [SEQ ID NO: 5 ].
    Petition 870190107951, of 10/24/2019, p. 150/188
    123/144 [253] Said AAV vectors are produced and evaluated for the yield of each vector according to Example 2. The efficiency of in vivo transduction and the tropism of tissue / organ / region are further evaluated by conventional methods, such as illustrated in Example 3.
    EXAMPLE 6 - AAVhu68 intrathecal.CMV.PI.htrastuzumab.SV40 for the prophylaxis of human brain metastases for HER2 + breast cancer
    AAV9 Adenoassociated virus 9 AAV9.trastuzumab AAV9CMV.PI.htrastuzumab.SV40 (AAV9 carrying a trastuzumab expression cassette) BCA Bicinconinic acid assay BCBM Brain metastases in breast cancer Cl chimeric intron CMV (Promoter) Immediate cytomegalovirus enhancer / chicken beta-actin promoter CSF Cerebrospinal fluid ddPCR Digital droplet polymerase chain reaction DNA Deoxyribonucleic acid GC Genome copies GLP Good laboratory practices GTP Gene Therapy Program HER2 Human epidermal growth factor 2 receptor AAVhu68 Adenoassociated virus serotype hu68 AAVhu68.trastuzumab hu68.CMV.PI.htrastuzumab.SV40 (AAVhu68 carrying a trastuzumab expression cassette) ICV Intracerebroventricular ID Identification number IT Intrathecal mAb Monoclonal antibody MED Minimum essential dose η Number of Animals PBS Phosphate saline buffer qPCR Quantitative Polymerase Chain Reaction RAG1 / _ Knockout of recombination activation gene 1 RAG1 Recombination activation gene 1 rBG Rabbit β-globin poly A sequence
    Petition 870190107951, of 10/24/2019, p. 151/188
    124/144
    RPM Rotation per minute SD Standard deviation SOP Standard operational procedure SV40 (Poly A signal) Simian 40 polyadenylation signal
    A. Summary [254] The aim of this study was to test the therapeutic efficacy of AAVhu68.CMV.PI.htrastuzumab.SV40 (AAVhu68.trastuzumab), an adeno-associated recombinant virus of serotype AAVhu68 containing a trastuzumab expression cassette, for prophylaxis of human brain metastases from HER2 + breast cancer in a mouse xenograft model. Trastuzumab (Herceptin®, Roche) is a humanized monoclonal antibody (mAb) directed against HER2 that prolongs patient survival when used intravenously with chemotherapy to treat systemic HER2 + disease. However, the blood-brain barrier excludes Herceptin®, administered intravenously, to enter the central nervous system, making effective treatment of brain metastases from HER2 + breast cancer impossible. Several case reports indicate that Herceptin® administered intrathecally may increase the survival of patients with HER2 + leptomeningeal disease or halt the progression of focal HER2 + metastases [J. C. Bendell, et al, Central nervous system metastases in women who receive trastuzumab-based therapy for metastatic breast carcinoma. Cancer. 97, 2972-2977 (2003); D. J. Slamon, et al., Use of Chemotherapy plus a Monoclonal Antibody against HER2 for Metastatic Breast Cancer That Overexpresses HER2. N. Engl. J. Med. 344, 783792 (2001), M. A. Cobleigh, et al, Multinational study of the efficacy and safety of humanized anti-HER2 monoclonal antibody in women who have HER2-overexpressing metastatic breast cancer that has progressed after chemotherapy for metastatic disease. J. Clin. Oncol. 17, 2639-2648 (1999), Zagouri F, et al., (2013). Intrathecal administration of trastuzumab for the treatment of meningeal carcinomatosis in HER2
    Petition 870190107951, of 10/24/2019, p. 152/188
    125/144 positive metastatic breast cancer: a systematic review and pooled analysis. Breast Cancer Res Treat, 139 (1): 13-22., Bousquet G, et al. (2016). Intrathecal Trastuzumab Halts Progression of CNS Metastases in Breast Cancer. J Clin Oncol. 34 (16): e151-155]. However, CSF turns quickly, probably compromising the therapeutic effect of IT Herceptin® due to a widely fluctuating pharmacokinetic profile of CSF. The goal of treatment with AAVhu68.trastuzumab is to prevent the occurrence, delay growth, improve survival or increase the clinical quality of life measures associated with HER2 + BCBM, providing localized and long-term expression of AAVhu68.trastuzumab in the brain parenchyma itself.
    [255] AAVhu68.trastuzumab was administered in four different doses (1.00X10 10 , 3.00X10 10 , 1.00X10 11 , and 3.00X10 11 GC / animal) by intracranioventricular injection (ICV) in RAG1 7 mice at age 6-9 weeks. BT474.Ml.fluc cells, derived from a human ductal carcinoma cell line HER2 +, were implanted at least 21 days later. The mice were observed daily and sacrificed at the end of the study. Brain tissue was collected at necropsy to measure tumor volume. Prophylactic administration of AAVhu68 by ICV.CMV.PI.htrastuzumab.SV40 in a RAG1 'xenograft model of HER2 + breast cancer brain metastases was completed resulting in a significantly reduced tumor volume at all doses tested in this experiment. In total, these results demonstrated the potential therapeutic efficacy of AAVhu68.trastuzumab to improve the survival of patients with HER2 + BCBM.
    B. The objective of this study was to investigate the essential minimum dose (MED) of AAVhu68.trastuzumab in a prophylaxis for tumor xenograft model RAGT / HER2 + _ BCBM through the study of tumor volume. The vector is AAVhu68.CMV.PI.htrastuzumab.SV40 or AAVhu68.trastuzumab.
    Petition 870190107951, of 10/24/2019, p. 153/188
    126/144
    DdPCR Title: 7.38X10 13 GC / ml
    Endotoxin: <2.0 EU / ml
    Purity: 100%
    Phosphate buffered saline (PBS) (no treatment control) [256] The ability of AAVhu68.trastuzumab to provide tumor prophylaxis was assessed using a HER2 + BCBM RAG1 / - murine xenograft model. An immunodeficient mouse model allows the growth of human orthotopic tumors in a mouse without rejection by the mouse's immune system. In addition, the RAG1 - / - mouse has no intrinsic IgG, allowing trastuzumab to be quantified by the protein A ELISA.
    Table: Study Design
    S Group C Treatment Dose(GC / mice)Genotype (n) Dose volume (μΙ) ROA Tumor CellImplantation 1 AAVhu68.trastuzumab 1.0X1 o 10 RAGVflO) 5 ICV 21 days after treatment 2 AAVhu68.trastuzumab 3.0X10 10 RAGVflO) 5 ICV 3 AAVhu68.trastuzumab 1.0X10RAG1 z (10) 5 ICV 4 AAVhu68.trastuzumab 3.0X10RAG1 z (10) 5 ICV 5 PBS No treatmentRAG1 z (10) 5 ICV
    257] The test article and negative control were diluted with sterile phosphate buffered saline (PBS) to the appropriate concentration. The vector was administered ICV in the left lateral ventricle.
    [258] Intrathecal delivery of AAV can be performed using a variety of routes to access the CSF. The ICV route was chosen because it is minimally invasive and does not require a surgical procedure in the mouse (compared to the magna cistern route that requires
    Petition 870190107951, of 10/24/2019, p. 154/188
    127/144 incisions in the skin and neck muscles). It has been previously shown in our laboratory and by others that a single injection of the AAV9 vector into cerebrospinal fluid (ICV or cisterna magna) in mice and large animals affects neurons throughout the brain [Dirren et al. (2014). Intracerebroventricular Injection of Adenoassociated Virus Vectors 6 and 9 for Expression of Cell Type Specific Transgene in the Spinal Cord. Hum. Gene. Therapy 25, 109-120, Snyder et al. (2011). Comparison Of Adeno-Associated Viral Vector Serotypes For Spinal Cord And Motor Neuron Gene Delivery. Hum. Gene Ther 22, 1129-1135, Bucher et al. (2014). Intracisternal Delivery Of AAV9 Results In Oligodendrocyte And Motor Neuron Transduction In The Whole Central Nervous System Of Cats. Gene Therapy 21, 522-528, Hinderer et al. (2014). Intrathecal Gene Therapy Corrects CNS Pathology In A Feline Model Of Mucopolysaccharidosis I. Mol Ther: 22, 2018-2027],
    C. Implantation of tumor cells in RAG1 - / - Mice [259] To create a mouse xenograft model for HER2 + BCBM, a human HER2 + ductal carcinoma cell line transduced with firefly luciferase, BT474M1 .ffluc, was used. For the injection procedure, the mice were anesthetized with ketamine / xylazine. Hairs on the scalp and neck were cut. A time-release estradiol 17-β pellet (1.7 mg, 90-day release, Innovative Research of America) was implanted subcutaneously on the back of the neck and re-administered every 90 days during the study. The mice were fixed in a stereotactic device. The exposed skin was cleaned with povidone-iodine and 70% ethanol. A 1 cm anterior-posterior incision was made at the top of the skull. Bregma has been identified. A pneumatic drill was positioned in bregma and then moved 0.8 mm to the rear and
    2.2 mm to the left of the bregma, where a trepanation hole was
    Petition 870190107951, of 10/24/2019, p. 155/188
    128/144 perforated in the skull. A 25 μΙ_ Hamilton syringe was loaded with 5 μΙ_ of tumor cell suspension (100,000 cells in total in 50:50 MatriGel®: PBS). The needle was taken to the bregma and moved to the coordinates indicated above, before penetrating 4.0 mm into the cerebral parenchyma. The needle was then lifted 1.0 mm back onto the needle track to create a pocket for injecting tumor cells. The needle was left in place for 5 minutes. Then, 5 μΙ_ of cell suspension was injected for 10 minutes using a motorized injection device. The needle was left in place for 5 minutes after the end of the injection and then removed slowly. The skull incision was sutured with 4.0 vicryl and the mice received 15 mg / kg of enrofloxacin (Bayer) in sterile PBS, along with 0.3 mg / kg of buprenorphine in sterile PBS, both subcutaneously.
    [260] The mice were monitored daily. When dying, the mice were sacrificed by overexposure to CO2 followed by cervical dislocation. At necropsy, the brains were isolated and coronarily cut through the tumor injection needle track.
    [261] Tumor volume: the tumor diameter measurement on day 35 was performed with digital Vernier forceps (Thermo-Fisher). The brains were collected at necropsy. Blunt dissection in the tumor injection needle track was used to isolate tumors from the surrounding brain tissue. The tumor diameter was then measured in 3 dimensions (x, y and z) and the tumor volume was calculated as the volume of an ellipsoid, 4/3 * π * x / 2 * y / 2 * z / 2. The right cerebral hemisphere, the hemisphere contralateral to the site of the vector injection and tumor implantation, was preserved in formalin. The dissected tumors were collected by dose cohort and preserved in formalin. Comparisons of tumor volume were performed using the Mann-Whitney test on the GraphPad Prism 7.
    Petition 870190107951, of 10/24/2019, p. 156/188
    129/144
    D. Results [262] Tumor volume: to determine whether prophylaxis of the IT tumor AAVhu68.trastuzumab decreases tumor growth, we measured the diameter of the tumor 35 days after implantation. The average volume of tumors in the group that received the highest dose of tumor prophylaxis for AAVhu68.trastuzumab (0.4 mm 3 , n = 10) was significantly less than the mice that did not receive treatment (26.1 mm 3 , n = 9). Mice that received lower doses of AAVhu68.trastuzumab had significantly smaller tumors compared to no treatment. The median tumor volume of mice that received 1.00 × 10 10 GC / mouse was calculated to be statistically equal to the median tumor volume of mice that received 3.00 × 10 10 GC / mouse (p = 0.6029). Of note, two mice in group 1, one mouse in group 2, three mice in group 3 and three mice in group 4 did not show a grossly appreciable tumor after dissection.
    Group Dose (GC / mouse) Number of mice Average tumor volume (mm 3 ) P value compared to no treatment 1 1.00X10 10 9 * 6.4 0.0375 2 3.00X10 10 10 8.1 0.00533 1.00X1 o 11 9 * 1.3 0.0026 4 3.00X10 11 10 0.4 <0.0001
    * One animal in each of these groups was euthanized before the scheduled necropsy date and was therefore not included in the analysis.
    [263] At all doses, administration of AAVhu68.trastuzumab by IT led to a significantly lower median tumor volume in the post-tumor D35 implant when administered prophylactically in a HER2 + BCBM murine RAG1 7 xenograft model using HER2 + BT474.Human ductal carcinoma cell line M1. The AAVhu68.trastuzumab MED measured in this study was 1.00X10 10 GC / mouse.
    Petition 870190107951, of 10/24/2019, p. 157/188
    130/144
    EXAMPLE 7 - Production yield and purity for AAVhu68 vectors [264] To compare the production yield and / or the purity of a recombinant adenoassociated vector (rAAV) with different capsids, two different sets of vectors with different capsids were generated and prepared, including AAVhu68, AAV8 triple, AAV8 and AAV9.
    [265] Briefly, a set of vectors with an indicated capsid and a vector genome comprising a cytomegalovirus (CMV) promoter, a firefly luciferase coding sequence and an SV40 poly A (CMV.ffLuciferase.SV40) were produced and evaluated on the yield of each small scale vector. The results show that the AAV9 vectors provided the highest yield while the AAVhu68 vector followed as the second (FIG 8A). The triple vectors of AAV8 and AAV8 also provided a yield above 4x10 13 GC (FIG 8A).
    [266] The other set of vectors with an indicated capsid and a vector genome comprising a CMV promoter, an intron, an immunoadhesin coding sequence (201 Ig IA) and a SV40 poly A (CMV.PI.201 Ig IA .SV40) were produced and evaluated for the yield and purity of each vector in mega scale according to conventional methods. The results are shown in FIGURES 8B and 9.
    [267] Similar to the yield of small-scale preparations, the AAV9 vectors provided the highest yield in about 5.7x10 14 GC, while the vector AAVhu68 followed as the second in about 3.8x10 14 GC (FIG 8B). The AAV8 vectors provided a yield of about 3.6x10 14 GC and the triple AAV8 yielded about 1.8x10 14 GC (FIG 8B). The purities of the tested preparations are comparable, ranging from about 97.4% to about 98.6%.
    EXAMPLE 8 - Vectors of rAAV in male RAG KO mice.
    [268] Gene expression was tested in vivo using vectors of
    Petition 870190107951, of 10/24/2019, p. 158/188
    131/144 rAAV with different capsids, including AAVhu68, AAV8 triple, AAV8 and AAV9 and expressing a secreted transgene product, 201 Ig IA.
    [269] Male RAG KO mice 6-8 weeks old (n = 5 / group) were intramuscularly in the gastrocnemius muscle with 3x10 11 GC / mouse or 3x10 10 GC / mouse vector tested using a Hamilton syringe. Serum was collected weekly from mice administered vectors that express proteins secreted by submandibular bleeding in serum collection tubes. Levels of transgene expression were measured in serum by ELISA, as described in Greig et al., Intramuscular Injection of AAV8 in Mice and Macaques Is Associated with Substantial Hepatic Targeting and Transgene Expression, PLoS One. November 13, 2014; 9 (11): e112268. doi: 10.1371 / journal.pone.0112268. eCollection 2014.
    [270] As shown in FIGS 10A and 10B, vectors AAVhu68, AAV8 and AAV9 expressed the transgene at a similar level, while the triple vector AAV8 expresses best after IM injection in mice. At the lowest dose tested (ie, 3x10 10 GC / mouse), the difference in expression of triple AAV8 is substantial.
    EXAMPLE 9 - Transgenic expression of rAAV vectors in male C57BL / 6J mice.
    [271] Liver and muscle expression was tested in vivo using rAAV vectors with different capsids, including AAVhu68, AAV8 triple, AAV8 and AAV9 and expressing a firefly luciferase (ffLuc) as a transgene.
    [272] Male C57BL / 6J mice 6-8 weeks of age (n = 5 / group) were intramuscularly into the gastrocnemius muscle with 3x10 11 GC / vector mice tested using a Hamilton syringe. The expression of ffLuc was visualized by weekly bioluminescence image as previously described (Greig et al., PLoS One 2014, cited above).
    Petition 870190107951, of 10/24/2019, p. 159/188
    132/144 [273] As shown in FIGS 11A and 11B, vectors AAVhu68, AAV8 and AAV9 were expressed at a similar level in muscle and liver, while vector AAV8 triple reduced expression in the liver and improved expression in muscle.
    EXAMPLE 10 - Vectors of rAAV in male and female Cynomolgus monkeys.
    [274] Transgene expression was tested in Cynomolgus monkeys using rAAV vectors with different capsids, including AAVhu68, AAV8 triple, AAV8 and AAV9 and expressing a secreted transgene, 201 Ig IA.
    [275] Male and female cynomolgus monkeys with NAb titers for the injected vector <1: 5 at baseline were administered a dose of 10 13 GC / kg body weight of the vector expressing 201 Ig IA from one of the four capsids in the vector (AAV8 triple, AAVhu68, AAV9 or AAV8) intramuscularly into the vastus lateralis muscle of the right and left legs as injections of 1 ml per kg of body weight (concentration of 10 13 GC / ml) for the study of vector biodistribution. Blood samples were collected pre-study and weekly during the study by venipuncture of the femoral vein. Levels of transgene expression were measured in serum by ELISA as previously described (Greig etal., PLoS One 2014, cited above).
    [276] As shown in FIG12, AAVhu68 and AAV8 triple express better compared to vectors AAV9 and AAV8 after IM injection.
    [277] All documents cited in this specification are hereby incorporated by reference, as is US Provisional Patent Application No. 62 / 614,002, filed on January 5, 2018, US Provisional Patent Application No. 62 / 591,001, filed on November 27, 2017, and US Provisional Patent Application No. 62 / 464,748, filed
    Petition 870190107951, of 10/24/2019, p. 160/188
    133/144 on February 28, 2017. The String Listing shown in this document, labeled 17-7986 Seq Listing_ST25.txt, and the strings and text are incorporated by reference. Although the invention has been described with reference to particular embodiments, it will be appreciated that modifications can be made without departing from the spirit of the invention. Such modifications are intended to remain within the scope of the appended claims.
    [278] (Free Text Sequential Listing) [279] The following information is provided for strings that contain free text under the numeric identifier <223>.
    SEQ ID NO: (containing free text) Free Text under <223> 2 <223> Synthetic construct 3 <223> AAVhu68 rep gene of homo sapiens origin 4 <223> Synthetic construct 5 <223> VP1 AAV9 capsid of homo sapiens origin<220><221> CDS<222> (1) .. (2208)<223> Capsid VP1 AAV9 6 <223> Synthetic construct 7 <223> Primary prm504 8 <223> Primary prm505 9 <223> AAVhu68 spacer string 10 <223> AAVhu31 vp1 capsid protein 11 <223> AAVhu32 vp1 capsid protein 12 <223> AAVhu31 vp1 encoding sequence 13 <223> AAVhu32 vp1 encoding sequence 14 <223> hu68vp1 modified
    Petition 870190107951, of 10/24/2019, p. 161/188
    134/144
    SEQ ID NO: (containing free text) Free Text under <223><220><221> MISC_FEATURE<222> (23) .. (23)<223> Xaa can be W (Trp, tryptophan) or oxidized W.<220><221> MISC-FEATURE<222> (35) .. (35)<223> Xaa can be Asn or deamidated in Asp, isoAspor Asp / isoAsp<220><221> MISC_FEATURE<222> (57) .. (57)<223> Xaa can be Asn or deamidated in Asp, isoAspor Asp / isoAsp<220><221> MISC_FEATURE<222> (66) .. (66)<223> Xaa can be Asn or deamidated in Asp, isoAspor Asp / isoAsp<220><221> MISC_FEATURE
    Petition 870190107951, of 10/24/2019, p. 162/188
    135/144
    SEQ ID NO: (containing free text) Free Text under <223><222> (94) .. (94)<223> Xaa can be Asn or deamidated in Asp, isoAsp or Asp / isoAsp<220><221> MISC-FEATURE<222> (97) .. (97)<223> Xaa can be D (asp, aspartic acid) or D. isomerized.<220><221> MISC_FEATURE<222> (107) .. (107)<223> Xaa can be D (asp, aspartic acid) or D. isomerized.<220><221> misc_feature<222> (113) .. (113)<223> Xaa can be any naturally occurring amino acid<220><221> MISC_FEATURE<222> (149) .. (149)<223> Xaa can be S (Ser, serine) or phosphorylated S
    Petition 870190107951, of 10/24/2019, p. 163/188
    136/144
    SEQ ID NO: (containing free text) Free Text under <223><220><221> MISC_FEATURE<222> (149) .. (149)<223> Xaa can be S (Ser, serine) or phosphorylated S<220><221> MISC-FEATURE<222> (247) .. (247)<223> Xaa can be W (Trp, tryptophan) or oxidized W. (for example, kinurenine).<220><221> MISC_FEATURE<222> (253) .. (253)<223> Xaa can be Asn or deamidated in Asp, isoAsp or Asp / isoAsp<220><221> MISC_FEATURE<222> (259) .. (259)<223> Xaa represents Q or Q deamidated in glutamic acid(alpha-glutamic acid), gamma-glutamic acid (Glu) or a mixture ofalpha and gamma-glutamic acid<220>
    Petition 870190107951, of 10/24/2019, p. 164/188
    137/144
    SEQ ID NO: (containing free text) Free Text under <223><221> MISC_FEATURE<222> (270) .. (270)<223> Xaa can be Asn or deamidated in Asp, isoAsp or Asp / isoAsp<220><221> MISC_FEATURE<222> (297) .. (297)&lt; 223 &gt; Xaa represents D (Asp, aspartic acid) or D to N amine (Asn, asparagine)<220><221> MISC_FEATURE<222> (304) .. (304)<223> Xaa can be Asn or deamidated in Asp, isoAsp or Asp / isoAsp<220><221> MISC_FEATURE<222> (306) .. (306)<223> Xaa can be W (Trp, tryptophan) or oxidized W. (for example, kinurenine).<220><221> MISC_FEATURE<222> (314) .. (314)
    Petition 870190107951, of 10/24/2019, p. 165/188
    138/144
    SEQ ID NO: (containing free text) Free Text under <223><223> Xaa can be Asn or deamidated in Asp, isoAsp or Asp / isoAsp<220><221> MISC-FEATURE<222> (319) .. (319)<223> Xaa can be Asn or deamidated in Asp, isoAsp or Asp / isoAsp<220><221> MISC_FEATURE<222> (329) .. (329)<223> Xaa can be Asn or deamidated in Asp, isoAsp or Asp / isoAsp<220><221> MISC_FEATURE<222> (332) .. (332)<223> Xaa can be K (lys, lysine) or acetylated K<220><221> MISC_FEATURE<222> (336) .. (336)<223> Xaa can be Asn or deamidated in Asp, isoAsp or Asp / isoAsp<220>
    Petition 870190107951, of 10/24/2019, p. 166/188
    139/144
    SEQ ID NO: (containing free text) Free Text under <223><221> MISC_FEATURE<222> (384) .. (384)<223> Xaa can be D (asp, aspartic acid) or D. isomerized.<220><221> MISC-FEATURE<222> (404) .. (404)<223> Xaa can be M (Met, Methionine) or oxidized M.<220><221> MISC_FEATURE<222> (409) .. (409)<223> Xaa can be Asn or deamidated in Asp, isoAsp or Asp / isoAsp<220><221> MISC_FEATURE<222> (436) .. (436)<223> Xaa can be M (Met, Methionine) or oxidized M.<220><221> MISC_FEATURE<222> (452) .. (452)<223> Xaa can be Asn or deamidated in Asp, isoAsp or Asp / isoAsp
    Petition 870190107951, of 10/24/2019, p. 167/188
    140/144
    SEQ ID NO: (containing free text) Free Text under <223><220><221> MISC_FEATURE<222> (477) .. (477)<223> Xaa can be Asn or deamidated in Asp, isoAsp or Asp / isoAsp<220><221> MISC-FEATURE<222> (499) .. (499)<223> Xaa can be S (Ser, serine) or phosphorylated S<220><221> MISC_FEATURE<222> (512) .. (512)<223> Xaa can be Asn or deamidated in Asp, isoAsp or Asp / isoAsp<220><221> MISC_FEATURE<222> (515) .. (515)<223> Xaa can be Asn or deamidated in Asp, isoAsp or Asp / isoAsp<220><221> MISC_FEATURE<222> (518) .. (518)<223> Xaa can be M (Met, Methionine) or oxidized M.
    Petition 870190107951, of 10/24/2019, p. 168/188
    141/144
    SEQ ID NO: (containing free text) Free Text under <223><220><221> MISC_FEATURE<222> (524) .. (524)<223> Xaa can be M (Met, Methionine) or oxidized M.<220><221> MISC-FEATURE<222> (559) .. (559)<223> Xaa can be M (Met, Methionine) or oxidized M.<220><221> MISC_FEATURE<222> (569) .. (569)<223> Xaa can be T (Thr, threonine) or phosphorylated T<220><221> MISC_FEATURE<222> (586) .. (586)<223> Xaa can be S (Ser, serine) or phosphorylated S<220><221> MISC_FEATURE<222> (599) .. (599)<223> Xaa represents Q or Q deamidated in glutamic acid(alpha-glutamic acid), gamma-glutamic acid (Glu) or
    Petition 870190107951, of 10/24/2019, p. 169/188
    142/144
    SEQ ID NO: (containing free text) Free Text under <223>a mixture ofalpha and gamma-glutamic acid<220><221> MISC_FEATURE<222> (605) .. (605)<223> Xaa can be M (Met, Methionine) or oxidized M.<220><221> MISC-FEATURE<222> (619) .. (619)<223> Xaa can be W (Trp, tryptophan) or oxidized W. (for example, kinurenine).<220><221> MISC_FEATURE<222> (628) .. (628)<223> Xaa can be Asn or deamidated in Asp, isoAsp or Asp / isoAsp<220><221> MISC_FEATURE<222> (640) .. (640)<223> Xaa can be M (Met, Methionine) or oxidized M.<220><221> MISC_FEATURE
    Petition 870190107951, of 10/24/2019, p. 170/188
    143/144
    SEQ ID NO: (containing free text) Free Text under <223><222> (651) .. (651)<223> Xaa can be Asn or deamidated in Asp, isoAsp or Asp / isoAsp<220><221> MISC-FEATURE<222> (663) .. (663)<223> Xaa can be Asn or deamidated in Asp, isoAsp or Asp / isoAsp<220><221> MISC_FEATURE<222> (666) .. (666)<223> Xaa can be K (lys, lysine) or acetylated K<220><221> MISC_FEATURE<222> (689) .. (689)<223> Xaa can be K (lys, lysine) or acetylated K<220><221> MISC_FEATURE<222> (693) .. (693)<223> Xaa can be K (lys, lysine) or acetylated K<220><221> MISC_FEATURE
    Petition 870190107951, of 10/24/2019, p. 171/188
    144/144
    SEQ ID NO: (containing free text) Free Text under <223><222> (695) .. (695)<223> Xaa can be W (Trp, tryptophan) or oxidized W.<220><221> MISC_FEATURE<222> (709) .. (709)<223> Xaa can be Asn or deamidated in Asp, isoAsp or Asp / isoAsp<220><221> MISC-FEATURE&lt; 222 &gt; (735) .. (735)<223> Xaa can be Asn or deamidated in Asp, isoAsp or Asp / isoAsp
    Petition 870190107951, of 10/24/2019, p. 172/188
    权利要求:
    Claims (42)
    [1]
    1. Recombinant Adenoassociated Virus (rAAV) characterized by the fact that it comprises:
    (A) an AAV68 capsid comprising one or more of the following:
    (1) AAV hu68 capsid proteins comprising:
    a heterogeneous population of AAVhu68 vp1 proteins selected from: vp1 proteins produced by expression from a nucleic acid sequence encoding the predicted 1-736 amino acid sequence of SEQ ID No: 2, vp1 proteins produced from SEQ ID No : 1, or vp1 proteins produced from a nucleic acid sequence at least 70% identical to SEQ ID No: 1, which encodes the predicted amino acid sequence from 1 to 736 of SEQ ID No: 2, a heterogeneous population of proteins AAVhu68 vp2 selected from: vp2 proteins produced by expression from a nucleic acid sequence encoding the predicted amino acid sequence of at least about amino acids 138-736 of SEQ ID NO: 2, vp2 proteins produced from a sequence that comprises at least nucleotides 412 to 2211 of SEQ ID No. 1, or vp2 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 412-2211 of SEQ ID N 1, which encodes the predicted amino acid sequence of at least about amino acids amino acids 138 to 736 of SEQ ID No: 2, a heterogeneous population of AAVhu68 vp3 proteins selected from: vp3 proteins produced by expression of a nucleic acid sequence encoding the predicted amino acid sequence of at least about amino acids 203-736 of SEQ ID NO: 2, vp3 proteins produced from a sequence comprising
    Petition 870190107951, of 10/24/2019, p. 173/188
    [2]
    2/10 at least nucleotides 607 to 2211 of SEQ ID No .: 1, or vp3 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 607-2211 of SEQ ID No .: 1 , which encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID No: 2; and / or (2) AAV capsid proteins comprising a heterogeneous population of vp1 proteins, a heterogeneous population of vp2 proteins optionally comprising a valine at position 157, and a heterogeneous population of vp3 proteins, wherein at least one subpopulation of the proteins vp2 and vp1 comprise a valine at position 157 and which optionally further comprises a glutamic acid at position 67 based on the vpl capsid numbering of SEQ ID NO: 2; and / or (3) a heterogeneous population of vp1 proteins that are the product of a nucleic acid sequence that encodes the amino acid sequence of SEQ ID NO: 2, a heterogeneous population of vp2 proteins, which are the product of a sequence of nucleic acid encoding the amino acid sequence of at least about amino acids 138-736 of SEQ ID NO: 2, and a heterogeneous population of vp3 proteins that are the product of a nucleic acid sequence encoding at least amino acids 203-736 of SEQ ID NO: 2, where: vp1, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated (N) asparagines in asparagine - glycine pairs in SEQ ID no: 2 and optionally further comprising subpopulations comprising other deamidated amino acids, in which the deamidation results in an alteration of an amino acid; and (B) a vector genome in the AAVhu68 capsid, the vector genome comprising a nucleic acid molecule comprising
    Petition 870190107951, of 10/24/2019, p. 174/188
    [3]
    3/10 giving repeated inverted terminal sequences of AAV and a non-AAV nucleic acid sequence that encodes a product operably linked to sequences that directly express the product in a host cell.
    2. Recombinant Adenoassociated Virus (rAAV) according to claim 1, characterized by the fact that deamidated asparagines are deamidated to aspartic acid, isoaspartic acid, an interconversion acid / isoaspartic acid pair, or combinations thereof.
    3. Recombinant Adenoassociated Virus (rAAV) according to claim 1 or 2, characterized by the fact that the capsid further comprises deamidated glutamine (s) which are deamidated with (a) glutamic acid, γ-glutamic acid, an Interconverting (a) glutamic acid / glutamic acid-γ pair, or combinations thereof.
    [4]
    4. Recombinant Adenoassociated Virus (rAAV) according to any one of claims 1 to 3, characterized by the fact that the AAVhu68 capsid comprises subpopulations having one or more of the following:
    (A) at least 65% of asparagines (N) in asparagine - glycine pairs located at positions 57 of the vpl proteins are deamidated, based on the numbering of SEQ ID NO: 2;
    (B) at least 75% N in asparagine - glycine pairs at position 329 of proteins vpl, v2 and vp3 are deamidated, based on the numbering of amino acid sequence residues of SEQ ID NO: 2, (C) at least 50% N in asparagine - glycine pairs at position 452 of the proteins vpl, vp2 and vp3 are deamidated, based on the number of residues in the amino acid sequence of SEQ ID NO: 2; and / or (D) at least 75% N in asparagine - glycine pairs
    Petition 870190107951, of 10/24/2019, p. 175/188
    4/10 at position 512 of vp1, proteins v2 and vp3 are deamidated, based on the number of residues in the amino acid sequence of SEQ ID NO: 2.
    [5]
    5. Recombinant Adenoassociated Virus (rAAV) according to any one of claims 1 to 4, characterized by the fact that the rAAVhu68 capsid comprises a subpopulation of vp1 in which 75% to 100% of a N in position 57 of the vp1 proteins are deamidated, as determined by mass spectrometry.
    [6]
    6. Recombinant Adenoassociated Virus (rAAV) according to any one of claims 1 to 5, characterized by the fact that the rAAVhu68 capsid comprises a subpopulation of vp1 proteins, vp2 and / or vp3 proteins in which 75% to 100% of N in position 329 , based on the numbering of SEQ ID NO: 2, are deamidated as determined by mass spectrometry.
    [7]
    Recombinant Adenoassociated Virus (rAAV) according to any one of claims 1 to 6, characterized by the fact that the rAAVhu68 capsid comprises a subpopulation of vp1 proteins, vp2 proteins and / or vp3 proteins in which 75% to 100% of N in position 452, based on the numbering of SEQ ID NO: 2, are deamidated as determined by mass spectrometry.
    [8]
    8. Recombinant Adenoassociated Virus (rAAV) according to any one of claims 1 to 7, characterized by the fact that the rAAVhu68 capsid comprises a subpopulation of vp1 proteins, vp2 proteins and / or vp3 proteins in which 75% to 100% N in position 512, based on the numbering of SEQ ID NO: 2, are deamidated.
    [9]
    Recombinant Adenoassociated Virus (rAAV) according to any one of claims 1 to 8, characterized in that the nucleic acid sequence encoding the proteins is SEQ ID NO: 1, or a sequence of at least 80% at at least 99% identical to SEQ ID NO: 1, which encodes the amino acid sequence of
    Petition 870190107951, of 10/24/2019, p. 176/188
    5/10
    SEQ ID NO: 2.
    [10]
    10. Recombinant Adenoassociated Virus (rAAV) according to claim 9, characterized in that the nucleic acid sequence is at least 80% to 97% identical to SEQ ID NO: 1.
    [11]
    11. Recombinant Adenoassociated Virus (rAAV) according to any one of claims 1 to 10, characterized by the fact that the rAAVhu68 capsid further comprises at least a subpopulation of vpl, VP2 and / or VP3 proteins having amino acid modifications from SEQ ID NO: 2, comprising at least about 100% SO deamination, at least four positions selected from one or more of N57, 329, 452, 512, or combinations thereof.
    [12]
    12. Recombinant Adenoassociated Virus (rAAV) according to any one of claims 1 to 11, characterized in that the rAAVhu68 capsid comprises subpopulations of vp1, vp2 and / or vp3 proteins which further comprise from 1% to about 40% deamidation at least one or more of the positions N94, N113, N252, N253, Q259, N270, N303, N304, N305, N319, N328, N336, N409, N410, N477, N515, N598, Q599, N628, N651, N663, N709, or combinations thereof.
    [13]
    13. Recombinant Adenoassociated Virus (rAAV) according to any one of claims 1 to 11, characterized by the fact that the rAAVhu68 capsid comprises subpopulations of vp1, vp2 and / or vp3 proteins that further comprise one or more modifications selected from one or more plus the modification in one or more of the following: acetylated lysine, phosphorylated serine and / or threonine, isomerized aspartic acid, oxidized tryptophan and / or methionine, or an amidated amino acid.
    [14]
    14. Recombinant Adenoassociated Virus (rAAV) according to any one of claims 1 to 13, characterized in that the rAAV comprises about 60 total capsid proteins in
    Petition 870190107951, of 10/24/2019, p. 177/188
    6/10 a ratio of about 1 vp1 to about 1 to 1.5 vp2 to about 3 to 10 vp3 proteins.
    [15]
    Recombinant Adenoassociated Virus (rAAV) according to any one of claims 1 to 14, characterized in that the rAAV comprises about 60 total capsid proteins in a ratio of about 1 vp1 to 1 vp2 to 3 to 9 proteins vp3.
    [16]
    16. Recombinant Adenoassociated Virus (rAAV) according to any one of claims 1 to 15, characterized in that the AAV ITR sequences are a 5 'ITR and an AAV 3' ITR from a source other than AAVhu68 .
    [17]
    17. Composition characterized by the fact that it comprises a mixed population of recombinant aduassociated hu68 virus (rAAVhu68), in which each of the rAAVhu68 is independently selected from an rAAV as defined in any of claims 1 to 16.
    [18]
    18. Composition according to claim 17, characterized in that the average rAAVhu68 comprises about 60 total capsid proteins in a ratio of about 1 vpl to 1 to 15 vp2 to about 3 to 10 vp3 proteins.
    [19]
    19. Composition according to claim 17 or 18, characterized in that the rAAV comprises an average of about 60 total capsid proteins in a ratio of about 1 vp1 to 1vp2 to 3 to 6 vp3 proteins.
    [20]
    Composition according to any one of claims 17 to 19, characterized in that the AAV ITR sequences are a 5 'ITR and an AAV 3' ITR from a source other than AAVhu68.
    [21]
    21. Composition according to any one of the claims
    Petition 870190107951, of 10/24/2019, p. 178/188
    7/10 cations 17 to 20, characterized by the fact that the composition is formulated for intrathecal delivery and the vector genome comprises a nucleic acid sequence that encodes a product for administration to the central nervous system.
    [22]
    22. Composition according to any one of claims 17 to 20, characterized in that the composition is formulated for intravenous administration.
    [23]
    23. Composition according to any one of claims 17 to 22, characterized in that the vector genome comprises a nucleic acid sequence encoding an anti-HER2 antibody.
    [24]
    24. Composition according to any one of claims 17 to 20, characterized in that the composition is formulated for intranasal or intramuscular delivery.
    [25]
    25. Recombinant Adenoassociated Virus (rAAV) according to any one of claims 1 to 16 or a composition according to any one of claims 17 to 24, characterized in that it is for the delivery of a desired gene product to a subject in need for it.
    [26]
    26. Use of an AAV according to any one of claims 1 to 16 or a composition according to any one of claims 17 to 24, characterized in that it is for the delivery of a desired gene product to a subject in need of same.
    [27]
    27. A rAAV production system useful for the production of a recombinant AAVhu68 as defined in any one of claims 1 to 16, characterized by the fact that the production system comprises:
    (A) a nucleic acid sequence of the AAVhu68 capsid that encodes the amino acid sequence of SEQ ID NO: 2;
    Petition 870190107951, of 10/24/2019, p. 179/188
    8/10 (B) a nucleic acid molecule suitable for packaging for the AAVhu68 capsid, said nucleic acid molecule comprising at least one inverted terminal repeat (ITR) AAV and a non-AAV nucleic acid sequence encoding a gene product operably linked to sequences that directly express the product in a host cell; and (C) sufficient AAV rep functions and helper functions to allow packaging of the nucleic acid molecule into the recombinant AAVhu68 capsid.
    [28]
    28. The system of claim 27, characterized in that the nucleic acid sequence of (a) comprises at least SEQ ID NO: 1, or a sequence of at least 70% to at least 99% identical to SEQ ID NO: 1, which encodes the amino acid sequence of SEQ ID NO: 2.
    [29]
    29. System according to claim 27 or 28, characterized in that the system optionally further comprises a nucleic acid sequence of about 607 to about nt nt 2211 of SEQ ID NO: 1 encoding the AAVhu68 vp3 of about aa 203 to about amino acid 736 of SEQ ID NO: 2.
    [30]
    System according to any one of claims 27 to 29, characterized in that the cell culture comprises human embryonic kidney 293 cells.
    [31]
    31. System according to any one of claims 27 to 30, characterized in that the rep of AAV is of a different AAV.
    [32]
    32. System according to claim 31, characterized by the fact that the rep of AAV is AAV2.
    [33]
    33. System according to any one of claims 27 to 32, characterized in that the rep coding genes for sequence and cap AAV are in the same nucleic acid molecule,
    Petition 870190107951, of 10/24/2019, p. 180/188
    9/10 where there is optionally a spacer between the rep and cap sequence of the gene.
    [34]
    34. System according to claim 33, characterized in that the spacer is atgacttaaaccaggt SEQ ID NO: 9.
    [35]
    35. System according to any one of claims 27 to 30, 33 and 34, characterized by the fact that the AAV rep is AAVhu68rep consisting of the amino acid sequence of SEQ ID NO: 4, or a functional fragment thereof.
    [36]
    36. System according to claim 35, characterized in that the AAV rep is encoded by the nucleic acid sequence of SEQ ID NO: 3.
    [37]
    37. Nucleic acid molecule characterized by the fact that it comprises a nucleic acid sequence that encodes a Rep AAVhu68 protein or a functional fragment thereof under the control of exogenous regulatory control sequences that direct the respective expression in a host cell, in which the Rep protein has the amino acid sequence of SEQ ID NO: 4.
    [38]
    38. Method for reducing the deamidation of an AA Vhu68 capsid, characterized by the fact that it comprises the production of an AAVhu68 capsid from a nucleic acid sequence containing modified vp AAVhu68 codons, the nucleic acid sequence comprising the modified glycine codons independently in
    1-3 of arginine - glycine pairs located at position 58, 330, 453 and / or 513 in SEQ ID NO: 2, such that the modified codon encodes an amino acid other than glycine.
    [39]
    39. Method for reducing the deamidation of an AAVhu68 capsid, characterized by the fact that it comprises the production of an AAVhu68 capsid from a nucleic acid sequence containing modified vp AAVhu68 codons, the nucleic acid sequence comprising independently modified arginine codons in 1-
    Petition 870190107951, of 10/24/2019, p. 181/188
    10/10
    3 of the arginine - glycine pairs located at position 57, 329, 452 and I or 512 in SEQ ID NO: 2, such that the modified codon encodes an amino acid other than arginine.
    [40]
    40. Method according to claim 38 or 39, characterized in that each modified codon encodes a different amino acid.
    [41]
    41. Method according to either of claims 38 or 39, characterized in that two or more modified codons encode the same amino acid.
    [42]
    42. Mutant rAAVhu68 recombinant adenoassociated virus characterized by the fact that it comprises a hu68 capsid with reduced deamidation, compared to an unmodified hu68 capsid, which is produced using the method as defined in any of claims 38 to 41.
    类似技术:
    公开号 | 公开日 | 专利标题
    US20200056159A1|2020-02-20|Novel adeno-associated virus | clade f vector and uses therefor
    US10689420B2|2020-06-23|AAV&#39;s and uses thereof
    US20200354714A1|2020-11-12|Novel high efficiency library-identified aav vectors
    US11014976B2|2021-05-25|Heterologous targeting peptide grafted AAVS
    US20210123073A1|2021-04-29|Novel adeno-associated virus | vectors, aav vectors having reduced capsid deamidation and uses therefor
    JP2021516046A|2021-07-01|Novel adeno-associated virus | vector, AAV vector with reduced capsid deamidation, and its use
    WO2021080991A1|2021-04-29|Aav3b variants with improved production yield and liver tropism
    同族专利:
    公开号 | 公开日
    ZA201905407B|2020-11-25|
    WO2018160582A1|2018-09-07|
    CL2019002474A1|2019-11-29|
    SG11201907714UA|2019-09-27|
    US20200056159A1|2020-02-20|
    WO2018160582A8|2019-09-12|
    IL268644D0|2019-10-31|
    JP2020510429A|2020-04-09|
    MA47687A|2021-03-31|
    CN110741082A|2020-01-31|
    EP3589730A1|2020-01-08|
    MX2019010275A|2019-10-15|
    CO2019009525A2|2019-09-18|
    SG10201912969XA|2020-02-27|
    SG10201912976WA|2020-02-27|
    KR20190132639A|2019-11-28|
    PE20191362A1|2019-10-01|
    SG10201912973XA|2020-03-30|
    AU2018227440A1|2019-08-29|
    CA3053399A1|2018-09-07|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    US5139941A|1985-10-31|1992-08-18|University Of Florida Research Foundation, Inc.|AAV transduction vectors|
    US5436146A|1989-09-07|1995-07-25|The Trustees Of Princeton University|Helper-free stocks of recombinant adeno-associated virus vectors|
    US6268213B1|1992-06-03|2001-07-31|Richard Jude Samulski|Adeno-associated virus vector and cis-acting regulatory and promoter elements capable of expressing at least one gene and method of using same for gene therapy|
    US5869305A|1992-12-04|1999-02-09|The University Of Pittsburgh|Recombinant viral vector system|
    US6204059B1|1994-06-30|2001-03-20|University Of Pittsburgh|AAV capsid vehicles for molecular transfer|
    US6093570A|1995-06-07|2000-07-25|The University Of North Carolina At Chapel Hill|Helper virus-free AAV production|
    US5741683A|1995-06-07|1998-04-21|The Research Foundation Of State University Of New York|In vitro packaging of adeno-associated virus DNA|
    NZ500546A|1997-04-14|2001-09-28|Cell Genesys Inc|Methods for increasing the production of high titre stocks of recombinant adeno-associated virus |
    US6146874A|1998-05-27|2000-11-14|University Of Florida|Method of preparing recombinant adeno-associated virus compositions|
    US6200560B1|1998-10-20|2001-03-13|Avigen, Inc.|Adeno-associated virus vectors for expression of factor VIII by target cells|
    US6221349B1|1998-10-20|2001-04-24|Avigen, Inc.|Adeno-associated vectors for expression of factor VIII by target cells|
    WO2000028004A1|1998-11-10|2000-05-18|The University Of North Carolina At Chapel Hill|Virus vectors and methods of making and administering the same|
    ES2478635T3|1999-08-09|2014-07-22|Targeted Genetics Corporation|Increased expression of a single stranded heterologous nucleotide sequence of recombinant viral vectors by designing the sequence so that it forms intracatenary base pairs|
    NZ522841A|2000-06-01|2004-12-24|Univ North Carolina|Surgically implantable matrix with a viral vector dried onto it for controlled release of recombinant parvovirus vectors|
    KR101015854B1|2001-11-13|2011-02-23|더 트러스티스 오브 더 유니버시티 오브 펜실바니아|A method of detecting and/or identifying adeno-associated virusaav sequences and isolating novel sequences identified thereby|
    AU2003274397A1|2002-06-05|2003-12-22|University Of Florida|Production of pseudotyped recombinant aav virions|
    US8005620B2|2003-08-01|2011-08-23|Dna Twopointo Inc.|Systems and methods for biopolymer engineering|
    WO2005012877A2|2003-08-01|2005-02-10|Dna Twopointo Inc.|Systems and methods for antibody engineering|
    CN102174574B|2003-09-30|2016-08-03|宾夕法尼亚大学托管会|Adeno associated virus is evolved, sequence, carrier containing these sequences and their application|
    US20060246079A1|2003-11-14|2006-11-02|Morrow Phillip R|Neutralizing human antibodies to anthrax toxin|
    DK2383346T3|2005-04-07|2015-01-05|Univ Pennsylvania|Modified AAVrh.64 capsids, compositions containing them and their uses|
    WO2006132118A1|2005-06-09|2006-12-14|Matsushita Electric Industrial Co., Ltd.|Amplitude error compensating apparatus and orthogonality error compensating apparatus|
    EP2007795B1|2006-03-30|2016-11-16|The Board Of Trustees Of The Leland Stanford Junior University|Aav capsid proteins|
    EP2018421B1|2006-04-28|2012-12-19|The Trustees of the University of Pennsylvania|Scalable production method for aav|
    WO2010138263A2|2009-05-28|2010-12-02|University Of Massachusetts|Novel aav 's and uses thereof|
    AU2011238708B2|2010-03-29|2016-02-11|The Trustees Of The University Of Pennsylvania|Pharmacologically Induced Transgene Ablation system|
    US8927514B2|2010-04-30|2015-01-06|City Of Hope|Recombinant adeno-associated vectors for targeted treatment|
    FR2977562B1|2011-07-06|2016-12-23|Gaztransport Et Technigaz|SEALED AND THERMALLY INSULATING TANK INTEGRATED IN A CARRIER STRUCTURE|
    WO2015012924A2|2013-04-29|2015-01-29|The Trustees Of The University Of Pennsylvania|Tissue preferential codon modified expression cassettes, vectors containing same, and use thereof|
    US10746742B2|2014-04-25|2020-08-18|Oregon Health & Science University|Methods of viral neutralizing antibody epitope mapping|
    EP3198018B1|2014-09-24|2020-12-09|City of Hope|Adeno-associated virus vector variants for high efficiency genome editing and methods thereof|
    AU2016344065A1|2015-10-28|2018-05-10|The Trustees Of The University Of Pennsylvania|Intrathecal administration of adeno-associated-viral vectors for gene therapy|
    HUE053747T2|2016-08-15|2021-07-28|Genzyme Corp|Methods for detecting aav|KR101015854B1|2001-11-13|2011-02-23|더 트러스티스 오브 더 유니버시티 오브 펜실바니아|A method of detecting and/or identifying adeno-associated virusaav sequences and isolating novel sequences identified thereby|
    CN102174574B|2003-09-30|2016-08-03|宾夕法尼亚大学托管会|Adeno associated virusis evolved, sequence, carrier containing these sequences and their application|
    AU2016332821B2|2015-09-28|2022-02-17|The University Of North Carolina At Chapel Hill|Methods and compositions for antibody-evading virus vectors|
    CA3091806A1|2018-02-27|2019-09-06|The Trustees Of The University Of Pennsylvania|Novel adeno-associated virusvectors, aav vectors having reduced capsid deamidation and uses therefor|
    EP3860659A1|2018-10-01|2021-08-11|The Trustees of the University of Pennsylvania|Compositions useful for treating gm1 gangliosidosis|
    UY38407A|2018-10-15|2020-05-29|Novartis Ag|TREM2 STABILIZING ANTIBODIES|
    CA3129672A1|2019-02-22|2020-08-27|The Trustees Of The University Of Pennsylvania|Recombinant adeno-associated virus for treatment of grn-associated adult-onset neurodegeneration|
    AU2020229772A1|2019-02-26|2021-08-26|The Trustees Of The University Of Pennsylvania|Compositions useful in treatment of krabbe disease|
    CA3135539A1|2019-05-03|2020-11-12|Juliette HORDEAUX|Compositions useful in treatment of metachromatic leukodystrophy|
    WO2021155337A1|2020-02-02|2021-08-05|The Trustees Of The University Of Pennsylvania|Compositions useful for treating gm1 gangliosidosis|
    WO2021231443A1|2020-05-12|2021-11-18|The Trustees Of The University Of Pennsylvania|Compositions useful in treatment of krabbe disease|
    WO2021231579A1|2020-05-12|2021-11-18|The Trustees Of The University Of Pennsylvania|Compositions for drg-specific reduction of transgene expression|
    WO2021242909A1|2020-05-26|2021-12-02|Shape Therapeutics Inc.|High throughput engineering of functional aav capsids|
    WO2022015715A1|2020-07-13|2022-01-20|The Trustees Of The University Of Pennsylvania|Compositions useful for treatment of charcot-marie-tooth disease|
    GB202111058D0|2020-07-30|2021-09-15|Shape Therapeutics Inc|Stable cell lines for inducible production of rAAV virions|
    WO2022046815A1|2020-08-24|2022-03-03|The Trustees Of The University Of Pennsylvania|Viral vectors encoding glp-1 receptor agonist fusions and uses thereof in treating metabolic diseases|
    WO2022046988A1|2020-08-26|2022-03-03|The Trustees Of The University Of Pennsylvania|Recombinant adeno-associated virus for treatment of grn-associated adult-onset neurodegeneration|
    法律状态:
    2021-10-19| B350| Update of information on the portal [chapter 15.35 patent gazette]|
    优先权:
    申请号 | 申请日 | 专利标题
    US201762464748P| true| 2017-02-28|2017-02-28|
    US201762591002P| true| 2017-11-27|2017-11-27|
    US201862614002P| true| 2018-01-05|2018-01-05|
    PCT/US2018/019992|WO2018160582A1|2017-02-28|2018-02-27|Adeno-associated virusclade f vector and uses therefor|
    [返回顶部]